Methods of treating cancer based on identifying mutations in the extracellular domain iii of epidermal growth factor receptor gene

Abstract

The invention relates to new identified mutations in the epidermal growth factor receptor gene, leading to amino acidic changes which highly correlate with the resistance to a therapy regimen comprising cetuximab. The invention includes peptide sequences and primers to detect the mutations, as well as kits for predicting the response of a subject to a therapy regime comprising cetuximab. In particular, the invention is useful in the therapy regimen applicable to metastasic colorectal cancer.

1 . A peptide sequence with a length from 17 to 100 amino acids and comprising the sequence SEQ ID NO: 13
 X 1 SLKEISDGDVIIX 4 X 5 NX 2 , wherein
 X 1  is selected from R and C; 
 X 4  is selected from S and L; 
 X 5  is selected from G and R;
 X 2  is selected from K and T; and wherein at least one of X 1 , X 4 , X 5  and X 2  is, respectively, C, L, R or T. 
 
   
     
     
         2 .- 17 . (canceled) 
     
     
         18 . An in vitro method of identifying, in a sample taken from a subject, the presence or absence of a cysteine at position 451 of the amino acid sequence corresponding to SEQ ID NO: 2; and/or the presence or absence of a leucine at position 464 of the amino acid sequence corresponding to SEQ ID NO: 2; and/or the presence or absence of an arginine at position 465 of the amino acid sequence corresponding to SEQ ID NO: 2; and/or the presence or absence of a threonine at position 467 of the amino acid sequence corresponding to SEQ ID NO: 2, the method comprising determining the sequence of SEQ ID NO: 2, at least from position 450 to position 470. 
     
     
         19 .- 20 . (canceled) 
     
     
         21 . A kit comprising
 (i) one or more oligonucleotide probes complementary to a portion of the EGFR gene and specific to a nucleotide change resulting in a mutation selected from the group consisting of R451C, S464L, G465R, and K467T; and/or   (ii) a set of primers designed to allow amplifying of a portion of the EGFR gene wherein a mutation selected from the group consisting of R451C, S464L, G465R, and K467T is located.   
     
     
         22 . The kit of  claim 21 , wherein the set of primers comprises SEQ ID NOssq sq: 6 (CAAAGTTTTCAGGGATACATTGTTTTT) and 7
 (TTAAATGGGAATAGCCCTTCAATATT).   
     
     
         23 . The kit of  claim 21 , wherein the one or more of the oligonucleotide probes are selected from:
 an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the R451C mutation and allows detecting the nucleotide change C→T at position 1351 of the mRNA variant 1 of the EGFR gene;   an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the S464L mutation and allows detecting the nucleotide change C→T at position 1391 of the mRNA variant 1 of the EGFR gene;   an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the G465R mutation and allows detecting the nucleotide change G→A at position 1393 of the mRNA variant 1 of the EGFR gene; or   an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the K467T mutation and allows detecting the nucleotide change A→C at position 1400 of the mRNA variant 1 of the EGFR gene.   
     
     
         24 . The kit of  claim 21 , wherein the one or more of the oligonucleotide probes are selected from those coding for any of SEQ ID NO: 1, 5, 8, 9, and 10. 
     
     
         25 . The kit of  claim 21 , further comprising additional reagents for detecting mutations in the KRAS and/or PIK3CA, and/or BRAF genes, and/or additional mutations in EGFR gene. 
     
     
         26 . The kit of  claim 25 , wherein the additional reagents comprise probes that detect mutations in the KRAS gene selected from the group consisting of G12A, G12C, G12D, G12R, G12S, G12V, G13A, G13C, G13D, or G13V. 
     
     
         27 . The kit of  claim 25 , wherein the additional reagents comprise probes that detect mutations in exons 9 and 20 of the PIK3CA gene. 
     
     
         28 . The kit of  claim 25 , wherein the additional reagents comprise probes that detect a V600E mutation of the BRAF gene. 
     
     
         29 . The kit of  claim 25 , wherein the additional reagents comprise probes that detect an S492R mutation in the EGFR protein of SEQ ID NO: 2. 
     
     
         30 . The kit of  claim 23 , wherein the one or more of the oligonucleotide probes are selected from
 an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the S464L mutation and allows detecting the nucleotide change C→T at position 1391 of the mRNA variant 1 of the EGFR gene;   an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the G465R mutation and allows detecting the nucleotide change G→A at position 1393 of the mRNA variant 1 of the EGFR gene; or   an oligonucleotide probe that specifically hybridizes with a fragment of the nucleotide sequence carrying the K467T mutation and allows detecting the nucleotide change A→C at position 1400 of the mRNA variant 1 of the EGFR gene.   
     
     
         31 . The kit of  claim 21  for determining the suitability of a therapy regimen for a human subject suffering from cancer.