Methods and compositions for pathogen detection in plants

Abstract

The technology relates in part to methods and compositions for detecting one or more pathogens in plants. In some aspects, the technology relates to methods and compositions for detecting hops latent viroid in plants. In some aspects, the technology relates to methods and compositions for detecting hops latent viroid in cannabis plants. In some aspects, the technology relates to methods and compositions for classifying a hops latent viroid genotype. In certain aspects, the technology relates to methods and compositions for determining the presence, absence and/or amount of one or more pathogens in plants, either independently or simultaneously. In aspects, the pathogen is a virus. In some aspects, the virus is selected from among one or more of hops latent viroid, beet curly top virus and alfalfa mosaic virus.

What is claimed is: 
     
         1 . A method for generating nucleic acid amplification products from a plant sample, comprising:
 contacting the nucleic acid of the plant sample with a set of loop mediated isothermal amplification (LAMP) polynucleotide primers under the amplification conditions, thereby generating one or more amplification products, wherein:   
       the majority or all of the polynucleotide primers hybridize to subsequences of SEQ ID NO:1, if present in the nucleic acid of the plant sample under the amplification conditions; 
       the subsequences of SEQ ID NO:1 to which the majority or all of the polynucleotide primers hybridize under the amplification conditions contain no variant nucleotide position; and 
       each subsequence of SEQ ID NO:1 between the subsequences to which the polynucleotide primers hybridize contain one or more variant nucleotide positions. 
     
     
         2 . The method of  claim 1 , comprising analyzing the amplification products. 
     
     
         3 . The method of  claim 1 , wherein the plant has been heat treated. 
     
     
         4 . The method of  claim 1 , wherein the plant has not been heat treated. 
     
     
         5 . The method of  claim 1 , wherein the plant is of the subclass Rosidae. 
     
     
         6 . The method of  claim 5 , wherein the plant is a  Cannabis  plant. 
     
     
         7 . The method of  claim 1 , wherein each polynucleotide in each primer pair comprises a sequence that is non-identical to any subsequence, or complement thereof, in a  Cannabis  genome. 
     
     
         8 . The method of  claim 2 , wherein the analyzing comprises detecting the presence or absence of a Hops Latent Viroid in the plant. 
     
     
         9 . The method of  claim 8 , wherein the analyzing comprises detecting one or more genetic variations in a Hops Latent Viroid. 
     
     
         10 . The method of  claim 1 , wherein the LAMP polynucleotide primer set is chosen from one or more of:
 a) a primer set comprising the polynucleotides of SEQ ID NO:21 to SEQ ID NO:29,   b) a primer set comprising the polynucleotides of SEQ ID NO:30 to SEQ ID NO:38,   c) a primer set comprising the polynucleotides of SEQ ID NO:39 to SEQ ID NO:47, and   d) a primer set comprising the polynucleotides of SEQ ID NO:48 to SEQ ID NO:56.   
     
     
         11 . The method of  claim 2 , wherein the analyzing comprises performing a high resolution melting (HRM) endpoint assay on the amplification products. 
     
     
         12 . The method of  claim 11 , wherein the analyzing comprises detecting one or more genetic variations in a Hops Latent Viroid according to results obtained from the high resolution melting (HRM) endpoint assay. 
     
     
         13 . The method of  claim 1 , wherein the subsequences of SEQ ID NO:1 to which the majority or all of the polynucleotide primers hybridize under the amplification conditions contain no thermomutant positions. 
     
     
         14 . The method of  claim 13 , wherein the thermomutant positions are chosen from one or more of nucleotide position 7 of SEQ ID NO:1, nucleotide position 10 of SEQ ID NO:1, nucleotide position 12 of SEQ ID NO:1, nucleotide position 26 of SEQ ID NO:1, nucleotide position 27 of SEQ ID NO:1, nucleotide position 28 of SEQ ID NO:1, nucleotide position 29 of SEQ ID NO:1, nucleotide position 30 of SEQ ID NO:1, nucleotide position 33 of SEQ ID NO:1, nucleotide position 35 of SEQ ID NO:1, nucleotide position 43 of SEQ ID NO:1, nucleotide position 59 of SEQ ID NO:1, nucleotide position 121 of SEQ ID NO:1, nucleotide position 128 of SEQ ID NO:1, nucleotide position 134 of SEQ ID NO:1, nucleotide position 150 of SEQ ID NO:1, nucleotide position 157 of SEQ ID NO:1, nucleotide position 162 of SEQ ID NO:1, nucleotide position 168 of SEQ ID NO:1, nucleotide position 169 of SEQ ID NO:1, nucleotide position 177 of SEQ ID NO:1, nucleotide position 200 of SEQ ID NO:1, nucleotide position 225 of SEQ ID NO:1, nucleotide position 229 of SEQ ID NO:1, nucleotide position 247 of SEQ ID NO:1, nucleotide position 248 of SEQ ID NO:1, and nucleotide position 253 of SEQ ID NO:1. 
     
     
         15 . A composition, comprising a set of loop mediated isothermal amplification (LAMP) polynucleotide primers, wherein:
 the majority or all of the polynucleotide primers hybridize to subsequences of SEQ ID NO:1, if present in the nucleic acid of the plant sample under the amplification conditions;   the subsequences of SEQ ID NO:1 to which the majority or all of the polynucleotide primers hybridize under the amplification conditions contain no variant nucleotide position; and   each subsequence of SEQ ID NO:1 between the subsequences to which the polynucleotide primers hybridize contain one or more variant nucleotide positions.   
     
     
         16 . The composition of  claim 15 , wherein the LAMP polynucleotide primer set is chosen from one or more of:
 a) a primer set comprising the polynucleotides of SEQ ID NO:21 to SEQ ID NO:29,   b) a primer set comprising the polynucleotides of SEQ ID NO:30 to SEQ ID NO:38,   c) a primer set comprising the polynucleotides of SEQ ID NO:39 to SEQ ID NO:47, and   d) a primer set comprising the polynucleotides of SEQ ID NO:48 to SEQ ID NO:56.   
     
     
         17 . The composition of  claim 15 , wherein the subsequences of SEQ ID NO:1 to which the majority or all of the polynucleotide primers hybridize contain no thermomutant positions. 
     
     
         18 . The composition of  claim 17 , wherein the thermomutant positions are chosen from one or more of nucleotide position 7 of SEQ ID NO:1, nucleotide position 10 of SEQ ID NO:1, nucleotide position 12 of SEQ ID NO:1, nucleotide position 26 of SEQ ID NO:1, nucleotide position 27 of SEQ ID NO:1, nucleotide position 28 of SEQ ID NO:1, nucleotide position 29 of SEQ ID NO:1, nucleotide position 30 of SEQ ID NO:1, nucleotide position 33 of SEQ ID NO:1, nucleotide position 35 of SEQ ID NO:1, nucleotide position 43 of SEQ ID NO:1, nucleotide position 59 of SEQ ID NO:1, nucleotide position 121 of SEQ ID NO:1, nucleotide position 128 of SEQ ID NO:1, nucleotide position 134 of SEQ ID NO:1, nucleotide position 150 of SEQ ID NO:1, nucleotide position 157 of SEQ ID NO:1, nucleotide position 162 of SEQ ID NO:1, nucleotide position 168 of SEQ ID NO:1, nucleotide position 169 of SEQ ID NO:1, nucleotide position 177 of SEQ ID NO:1, nucleotide position 200 of SEQ ID NO:1, nucleotide position 225 of SEQ ID NO:1, nucleotide position 229 of SEQ ID NO:1, nucleotide position 247 of SEQ ID NO:1, nucleotide position 248 of SEQ ID NO:1, and nucleotide position 253 of SEQ ID NO:1. 
     
     
         19 . The composition of  claim 15 , comprising one or more further polynucleotide primers wherein:
 each polynucleotide of the one or more further polynucleotide primers is identical, or substantially identical, to a subsequence of SEQ ID NO:1, or complement thereof;   each subsequence of SEQ ID NO:1, or complement thereof, to which each polynucleotide is identical, or substantially identical, contains one or more variant nucleotide positions.   
     
     
         20 . The composition of  claim 19 , wherein each further polynucleotide primer comprises a sequence that is non-identical to any subsequence, or complement thereof, in a  Cannabis  genome. 
     
     
         21 . The composition of  claim 19 , wherein the one or more further polynucleotide primers independently are chosen from a polynucleotide comprising the sequence CTACGTGACTTACCTGTATGGTGGC (SEQ ID NO:2), GTGAAGAAGGAGCCGTTCCA (SEQ ID NO:7), AGAGTTGTATTCACCGGGTAGTTTCC (SEQ ID NO:14), or GCACTTTTTATGTGAACTTCTGC (SEQ ID NO:15). 
     
     
         22 . The composition of  claim 21 , wherein the one or more further polynucleotide primers consist of CTACGTGACTTACCTGTATGGTGGC (SEQ ID NO:2), GTGAAGAAGGAGCCGTTCCA (SEQ ID NO:7), AGAGTTGTATTCACCGGGTAGTTTCC (SEQ ID NO:14), and GCACTTTTTATGTGAACTTCTGC (SEQ ID NO:15). 
     
     
         23 . A method for determining the presence, absence and/or amount of at least one pathogen in a plant cultivar, comprising:
 (a) obtaining a nucleic acid sample from the plant cultivar;   (b) contacting the nucleic acid sample with more than one polynucleotide primer pair under amplification conditions and amplifying the sample, thereby preparing an amplified nucleic acid mixture, wherein, if at least one pathogen is present, at least one polynucleotide primer pair is capable of specifically hybridizing to and amplifying a subsequence of the nucleic acid of the pathogen, or to a complement thereof, wherein the subsequence of the nucleic acid of the pathogen, or the complement thereof, is non-identical to any subsequence of the nucleic acid of the plant genome, or to any complement thereof; and   (c) determining the presence, absence and/or amount of at least one amplicon that is an amplification product of a polynucleotide primer pair in the amplified nucleic acid mixture of (b), thereby determining the presence, absence and/or amount of a pathogen in the plant cultivar.   
     
     
         24 . The method of  claim 23 , wherein:
 each of the polynucleotide primer pairs hybridizes to the nucleic acid of the same pathogen;   each polynucleotide primer pair hybridizes to a subsequence of the nucleic acid of the pathogen that does not overlap with the subsequences to which each of the other primer pairs hybridizes; and   the presence, absence and/or amount of more than one amplicon of the pathogen that is obtained in (b) is determined in (c).   
     
     
         25 . The method of  claim 23 , wherein:
 each of the polynucleotide primer pairs hybridizes to the nucleic acid of a pathogen that is different than the pathogens to which each of the other polynucleotide primer pairs hybridize; and   the presence, absence and/or amount of amplicons obtained from more than one pathogen in (b) is determined in (c).   
     
     
         26 . The method of  claim 23 , wherein the determining is by one or more of high-resolution melting (HRM), quantitative PCR (qPCR), RT-PCR, quantitative RT-PCR (RT-qPCR), loop-mediated isothermal amplification (LAMP), restriction endonuclease digestion, gel electrophoresis and sequencing. 
     
     
         27 . The method of  claim 23 , wherein the pathogen is a virus or viroid is selected from among Hops Latent Viroid (HpLVd), Alfalfa Mosaic Virus (AMV), Beet Curly Top Virus (BCTV), Hemp Streak Virus (HSV), Hemp Mosaic Virus (HMV), Tomato spotted wilt virus (TSWV), Sunn-Hemp Mosaic Virus (SHMV),  Arabis  Mosaic Virus (ArMV), Cucumber Mosaic Virus (CMV), Lettuce Chlorosis Virus (LCV), Tobacco Ringspot Virus (TRSV), Tomato Ringspot Virus (TomRSV), and Tobacco Streak Virus (TSV),  Cannabis  Cryptic Virus (CCV), Potato Spindle Tubular Viroid (PSTV), Coconut cadang cadang viroid (CCCV), Apple scar skin viroid (ASSV), Avocado sunblotch viroid (ASBV), Tobacco streak virus (TSV), Tomato mosaic virus (ToMV), Euonymous Ringspot Virus (ERSV), Elm Mosaic Virus (EMV), and Hops Stunting Virus (HpSV). 
     
     
         28 . A method for determining the presence, absence and/or amount of a pathogen in a plant cultivar, comprising:
 (a) obtaining a nucleic acid sample from the plant cultivar;   (b) contacting the nucleic acid sample with a polynucleotide primer pair under amplification conditions and amplifying the sample, thereby preparing an amplified nucleic acid mixture, wherein, if the pathogen is present, the polynucleotide primer pair is capable of specifically hybridizing to and amplifying a subsequence of the nucleic acid of the pathogen, or to a complement thereof, wherein the subsequence of the nucleic acid of the pathogen, or the complement thereof, is non-identical to any subsequence of the nucleic acid of the plant genome, or to any complement thereof; and   (c) determining the presence, absence and/or amount of at least one amplicon that is an amplification product of a polynucleotide primer pair in the amplified nucleic acid mixture of (b) by qPCR or RT-qPCR using more than one polynucleotide probe sequence, thereby determining the presence, absence and/or amount of a pathogen in the plant cultivar.   
     
     
         29 . The method of  claim 28 , wherein the more than one polynucleotide probe sequences hybridize to non-overlapping regions of the subsequence of the pathogen that is amplified to generate the amplicon. 
     
     
         30 . The method of  claim 28 , wherein the pathogen is a virus or viroid is selected from among Hops Latent Viroid (HpLVd), Alfalfa Mosaic Virus (AMV), Beet Curly Top Virus (BCTV), Hemp Streak Virus (HSV), Hemp Mosaic Virus (HMV), Tomato spotted wilt virus (TSWV), Sunn-Hemp Mosaic Virus (SHMV),  Arabis  Mosaic Virus (ArMV), Cucumber Mosaic Virus (CMV), Lettuce Chlorosis Virus (LCV), Tobacco Ringspot Virus (TRSV), Tomato Ringspot Virus (TomRSV), and Tobacco Streak Virus (TSV),  Cannabis  Cryptic Virus (CCV), Potato Spindle Tubular Viroid (PSTV), Coconut cadang cadang viroid (CCCV), Apple scar skin viroid (ASSV), Avocado sunblotch viroid (ASBV), Tobacco streak virus (TSV), Tomato mosaic virus (ToMV), Euonymous Ringspot Virus (ERSV), Elm Mosaic Virus (EMV), and Hops Stunting Virus (HpSV).