US2022056442A1PendingUtilityA1

Exon skipping compositions for treating muscular dystrophy

77
Assignee: SAREPTA THERAPEUTICS INCPriority: Mar 14, 2013Filed: Apr 19, 2021Published: Feb 24, 2022
Est. expiryMar 14, 2033(~6.7 yrs left)· nominal 20-yr term from priority
Inventors:Richard K. BestwickDiane Elizabeth FrankFrederick Joseph Schnell
C12N 15/113A61K 31/713C12N 2310/11A61P 43/00C12N 15/111A61P 21/04C12N 2310/351C12N 2310/3535C12N 2320/33C12N 2320/30A61K 47/6455A61K 47/60C12N 15/11C12N 2310/33A61P 21/00C12N 2310/3233C12N 2310/3513A61K 31/7088Y02A50/30
77
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 44 skipping are described.

Claims

exact text as granted — not AI-modified
1 .- 20 . (canceled) 
     
     
         21 . An antisense oligonucleotide of 24 bases comprising the base sequence CTGTTCAGCTTCTGTTAGCCACTG (SEQ ID NO: 12), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, or a pharmaceutically acceptable salt thereof. 
     
     
         22 . The antisense oligonucleotide of  claim 21 , wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide. 
     
     
         23 . The antisense oligonucleotide of  claim 21 , wherein the oligonucleotide is chemically linked to a polyethylene glycol moiety. 
     
     
         24 . A pharmaceutical composition comprising an antisense oligonucleotide of 24 bases comprising the base sequence CTGTTCAGCTTCTGTTAGCCACTG (SEQ ID NO: 12), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, and a pharmaceutically acceptable carrier. 
     
     
         25 . The pharmaceutical composition of  claim 24 , wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide. 
     
     
         26 . The pharmaceutical composition of  claim 24 , wherein the oligonucleotide is chemically linked to a polyethylene glycol moiety.

Join the waitlist — get patent alerts

Track US2022056442A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.