Methods and compositions using rna interference and antisense oligonucleotides for inhibition of kras

Abstract

The invention relates to the inhibition of expression of mutant KRAS sequences using RNA interference, antisense oligonucleotides, and chemically-modified oligonucleotides.

1 . An antisense oligonucleotide targeted to a synthetic human KRAS mRNA that encodes the missense mutations G12C, G12D, and G13D, wherein the antisense oligonucleotide is 16-25 nucleotides in length and comprises the sequence 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 114) 
                 
                     
                   TCTTGCCTACGTCATA. 
                 
             
                
                
               
            
           
         
       
     
     
         2 . (canceled) 
     
     
         3 . The antisense oligonucleotide of  claim 1 , consisting of the sequence CACTCTTGCCTACGTCATAA (SEQ ID NO:115) or GCACTCTTGCCTACGTCATA (SEO ID NO: 116). 
     
     
         4 . (canceled) 
     
     
         5 . The antisense oligonucleotide of  claim 1 , wherein the antisense oligonucleotide comprises at least one phosphorothioate linkage, optionally all phosphorothioate linkages. 
     
     
         6 . (canceled) 
     
     
         7 . The antisense oligonucleotide of  claim 1 , wherein the antisense oligonucleotide comprises at least one modified nucleotide at or near the 5′ end and/or the 3′ end, optionally at least three modified nucleotides at each of the 5′ end and the 3′ end. 
     
     
         8 . (canceled) 
     
     
         9 . The antisense oligonucleotide of  claim 7 , wherein the modified nucleotide is a 2′-O-methoxyethyl (2′-MOE)-modified nucleotide. 
     
     
         10 . The antisense oligonucleotide of  claim 9 , wherein the antisense oligonucleotide comprises at least three 2′-MOE-modified nucleotides at each of the 5′ end and/or the 3′ end. 
     
     
         11 . The antisense oligonucleotide of  claim 10 , wherein the antisense oligonucleotide consists of a sequence selected from: 
       
         
           
                 
                 
               
                     
                   a) 
                 
                     
                   (SEQ ID NO: 68) 
                 
                     
                     C * A * C * T * C *T*T*G*C*C*T*A*C*G*T* C * A * T * A * A ; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   b) 
                 
                     
                   (SEQ ID NO: 69) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* T * C * A * T * A ; 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
         wherein * indicates a phosphorothioate linkage and bold indicates a 2′-MOE-modified nucleotide. 
       
     
     
         12 . The antisense oligonucleotide of  claim 7 , wherein at least one modified nucleotide is a locked nucleic acid. 
     
     
         13 . An antisense oligonucleotide targeted to a naturally-occurring human KRAS mRNA encoding a mutation selected from G12C, G12D, G12V, and G13D, wherein the antisense oligonucleotide is 16-25 nucleotides in length and comprises a sequence selected from:
 a) TCTTGCCTACGCCACA (SEQ ID NO:117) targeted to a human KRAS mRNA encoding a G12C mutation;   b) TCTTGCCTACGCCATC (SEQ ID NO:118) targeted to a human KRAS mRNA encoding a G12D mutation;   c) TCTTGCCTACGCCAAC (SEQ ID NO:119) targeted to a human KRAS mRNA encoding a G12V mutation;   d) TCTTGCCTACGTCACC (SEQ ID NO:120) targeted to a human KRAS mRNA encoding a G13D mutation; or   e) a sequence at least 90% identical to any one of a) to d);   
       wherein the antisense oligonucleotide comprises at least one non-naturally occurring chemical modification. 
     
     
         14 . (canceled) 
     
     
         15 . The antisense oligonucleotide of  claim 13 , wherein the antisense oligonucleotide consists of a sequence selected from:
 a) GCACTCTTGCCTACGCCACA (SEQ ID NO:117) targeted to a human KRAS mRNA encoding a G12C mutation;   b) GCACTCTTGCCTACGCCATC (SEQ ID NO:118) targeted to a human KRAS mRNA encoding a G12D mutation;   c) GCACTCTTGCCTACGCCAAC (SEQ ID NO:119) targeted to a human KRAS mRNA encoding a G12V mutation; or   d) GCACTCTTGCCTACGTCACC (SEQ ID NO:120) targeted to a human KRAS mRNA encoding a G13D mutation.   
     
     
         16 . The antisense oligonucleotide of  claim 13 , wherein the antisense oligonucleotide comprises at least one phosphorothioate linkage, optionally all phosphorothioate linkages. 
     
     
         17 . (canceled) 
     
     
         18 . The antisense oligonucleotide of  claim 13 , wherein the antisense oligonucleotide comprises at least one modified nucleotide at or near the 5′ end and/or the 3′ end, optionally at least the modified nucleotides at each of the 5′ end and the 3′ end. 
     
     
         19 . (canceled) 
     
     
         20 . The antisense oligonucleotide of  claim 18 , wherein the modified nucleotide is a 2′-MOE-modified nucleotide. 
     
     
         21 . The antisense oligonucleotide of  claim 20 , wherein the antisense oligonucleotide comprises at least three 2′-MOE-modified nucleotides at each of the 5′ end and/or the 3′ end. 
     
     
         22 . The antisense oligonucleotide of  claim 21 , wherein the antisense oligonucleotide consists of a sequence selected from: 
       
         
           
                 
                 
               
                     
                   a) 
                 
                     
                   (SEQ ID NO: 70) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* C * C * A * C * A ; 
                 
                     
                     
                 
                     
                   b) 
                 
                     
                   (SEQ ID NO: 71) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* C * C * A * T * C ; 
                 
                     
                     
                 
                     
                   c) 
                 
                     
                   (SEQ ID NO: 72) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C'G* C * C*A * A * C ; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   d) 
                 
                     
                   (SEQ ID NO: 73) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* T * C * A * C * C ; 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         wherein * indicates a phosphorothioate linkage and bold indicates a 2′-MOE-modified nucleotide. 
       
     
     
         23 . The antisense oligonucleotide of  claim 18 , wherein at least one modified nucleotide is a locked nucleic acid. 
     
     
         24 . The antisense oligonucleotide of  claim 23 , wherein the antisense oligonucleotide consists of a sequence selected from: 
       
         
           
                 
                 
               
                     
                   a) 
                 
                     
                   (SEQ ID NO: 74) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* C * C * A * C *+A; 
                 
                     
                     
                 
                     
                   b) 
                 
                     
                   (SEQ ID NO: 75) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* C * C * A *+T*C; 
                 
                     
                     
                 
                     
                   c) 
                 
                     
                   (SEQ ID NO: 76) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G* C * C * A *+A*C; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   d) 
                 
                     
                   (SEQ ID NO: 77) 
                 
                     
                     G * C * A * C * T *C*T*T*G*C*C*T*A*C*G*+T* C * A * C * C ; 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         wherein * indicates a phosphorothioate linkage, bold indicates a 2′-methoxymethyl-modified nucleotide, and + indicates the following nucleotide is a locked nucleic acid. 
       
     
     
         25 . (canceled) 
     
     
         26 . A nucleic acid molecule encoding the antisense oligonucleotide of  claim 13 . 
     
     
         27 - 38 . (canceled) 
     
     
         39 . A composition comprising the antisense oligonucleotide of  claim 13 . 
     
     
         40 . A composition comprising two or more of the antisense oligonucleotide of  claim 13 , in any combination, wherein the two or more antisense oligonucleotides each comprise a different sequence. 
     
     
         41 - 42 . (canceled) 
     
     
         43 . A pharmaceutical composition comprising the antisense oligonucleotide of  claim 13  and a pharmaceutically acceptable carrier. 
     
     
         44 . (canceled) 
     
     
         45 . A method of treating cancer in a subject in need thereof, wherein the cancer comprises a mutant human KRAS gene comprising one or more of the missense mutations G12C, G12D, G12V, and G13D, the method comprising delivering to the subject the antisense oligonucleotide of  claim 13 , thereby treating cancer in the subject. 
     
     
         46 . (canceled)