RNAi Agents for Inhibiting Expression of Alpha-ENaC And Methods of Use

Abstract

Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an alpha-ENaC (SCNN1A) gene. The alpha-ENaC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an alpha-ENaC gene. Pharmaceutical compositions that include one or more alpha-ENaC RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described alpha-ENaC RNAi agents to epithelial cells, such as pulmonary epithelial cells, in vivo, provides for inhibition of alpha-ENaC gene expression and a reduction in ENaC activity, which can provide a therapeutic benefit to subjects, including human subjects.

1 . An RNAi agent for inhibiting expression of an alpha-ENaC gene, comprising:
 an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and   a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.   
     
     
         2 . The RNAi agent of  claim 1 , wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3. 
     
     
         3 . The RNAi agent of  claim 1 , wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand. 
     
     
         4 . The RNAi agent of  claim 1 , wherein at least one nucleotide of the alpha-ENaC RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. 
     
     
         5 . The RNAi agent of  claim 1 , wherein all or substantially all of the nucleotides are modified nucleotides. 
     
     
         6 . The RNAi agent of  claim 4 , wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide. 
     
     
         7 . The RNAi agent of  claim 5 , wherein all or substantially all of the nucleotides are modified with either 2′-O-methyl nucleotides or 2′-fluoro nucleotides. 
     
     
         8 . The RNAi agent of  claim 1 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3. 
     
     
         9 . The RNAi agent of  claim 1 , wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. 
     
     
         10 . The RNAi agent of  claim 1 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. 
     
     
         11 . The RNAi agent of  claim 1 , wherein the RNAi agent is linked to a targeting ligand. 
     
     
         12 . The RNAi agent of  claim 11 , wherein the targeting ligand comprises an integrin targeting ligand. 
     
     
         13 . The RNAi agent of  claim 12 , wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand. 
     
     
         14 . The RNAi agent of  claim 13 , wherein the αvβ6 integrin targeting ligand has the structure represented by any one of the structures of  FIGS. 4-11 . 
     
     
         15 . The RNAi agent of  claim 11 , wherein the targeting ligand is conjugated to the sense strand. 
     
     
         16 . The RNAi agent of  claim 15 , wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand. 
     
     
         17 . The RNAi agent of  claim 1 , wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length. 
     
     
         18 . The RNAi agent of  claim 17 , wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length. 
     
     
         19 . The RNAi agent of  claim 18 , wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length. 
     
     
         20 . The RNAi agent of  claim 19 , wherein the sense strand and the antisense strand are each 21 nucleotides in length. 
     
     
         21 . The RNAi agent of  claim 20 , wherein the RNAi agent has two blunt ends. 
     
     
         22 . The RNAi agent of  claim 1 , wherein the sense strand comprises one or two terminal caps. 
     
     
         23 . The RNAi agent of  claim 22 , wherein the sense strand comprises one or two inverted abasic residues. 
     
     
         24 . The RNAi agent of  claim 1 , wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 5. 
     
     
         25 . The RNAi agent of  claim 1 , wherein the RNAi agent is comprised of a sense strand and an antisense strand, wherein the antisense strand comprises a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′): 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 2) 
                 
                     
                   usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 6) 
                 
                     
                   usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc); 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 10) 
                 
                     
                   cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 107) 
                 
                     
                   usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg;  
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 152) 
                 
                     
                   asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu;  
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, cPrpu represents a 5′-cyclopropyl phosphonate-2′-O-methyl uridine; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. 
       
     
     
         26 . The RNAi agent of  claim 25 , wherein the sense strand further includes an abasic residue at the 3′ terminal end. 
     
     
         27 . The RNAi agent of  claim 1 , wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand comprise a nucleotide sequence pair selected from the group consisting of: SEQ ID NOs:2 and 4; SEQ ID NOs: 3 and 5; SEQ ID NOs: 6 and 8; SEQ ID NOs: 7 and 9; and SEQ ID NOs: 10 and 4. 
     
     
         28 . The RNAi agent of  claim 1 , wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05453, AD05625, AD05347, AD05831, AD05833, AD04835, and AD05924. 
     
     
         29 . The RNAi agent of  claim 1 , wherein the RNAi agent includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise nucleotide sequences that differ by 0 or 1 nucleotides from one of the following nucleotide sequence (5′→3′) pairs: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 3) 
                 
                     
                   UAUUUGUUCUGGUUGCACAGG 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 5) 
                 
                     
                   CCUGUGCAACCAGAACAAAUA; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   UAUUUGUUCUGGUUGCACAGC 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   GCUGUGCAACCAGAACAAAUA; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 230) 
                 
                     
                   UGAUUUGUUCUGGUUGCACAG 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 259) 
                 
                     
                   CUGUGCAACCAGAACAAAUCA; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 254) 
                 
                     
                   AGAAGUCAUUCUGCUCUGCUU 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 289) 
                 
                     
                   GCAGAGCAGAAUGACUUCUUU. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         30 . The RNAi agent of  claim 29 , wherein all or substantially all of the nucleotides are modified nucleotides. 
     
     
         31 . The RNAi agent of  claim 29 , wherein the sense strand of the RNAi agent is linked to targeting ligand. 
     
     
         32 . The RNAi agent of  claim 31 , wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell. 
     
     
         33 . The RNAi agent of  claim 31 , wherein the targeting ligand is an αvβ6 integrin targeting ligand. 
     
     
         34 . A composition comprising the RNAi agent of  claim 1 , wherein the composition comprises a pharmaceutically acceptable excipient. 
     
     
         35 . The composition of  claim 34 , further comprising a second RNAi agent for inhibiting the expression of alpha-ENaC. 
     
     
         36 . The composition of  claim 34 , further comprising one or more additional therapeutics. 
     
     
         37 . The composition of  claim 34 , wherein the composition is formulated for administration by inhalation. 
     
     
         38 . The composition of  claim 37 , wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler. 
     
     
         39 . A method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of  claim 1 . 
     
     
         40 . The method of  claim 39 , wherein the cell is within a subject. 
     
     
         41 . The method of  claim 40 , wherein the subject is a human subject. 
     
     
         42 . The method of  claim 39 , wherein the alpha-ENaC gene expression is inhibited by at least about 30%. 
     
     
         43 . A method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell an effective amount of the composition of  claim 34 . 
     
     
         44 . The method of  claim 43 , wherein the cell is within a subject. 
     
     
         45 . The method of  claim 44 , wherein the subject is a human subject. 
     
     
         46 . The method of  claim 43 , wherein the alpha-ENaC gene expression is inhibited by at least about 30%. 
     
     
         47 . A method of treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of  claim 34 . 
     
     
         48 . The method of  claim 47 , wherein the disease is a respiratory disease. 
     
     
         49 . The method of  claim 48 , wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, or lung carcinoma cystic fibrosis. 
     
     
         50 . The method of  claim 47 , wherein the disease is an ocular disease, such as dry eye syndrome. 
     
     
         51 . The method of  claim 44 , wherein the RNAi agent is administered at a dose of about 0.001 mg/kg to about 0.500 mg/kg of body weight. 
     
     
         52 . The method of  claim 51 , wherein the RNAi agent is administered in two or more doses. 
     
     
         53 . The method of  claim 47 , wherein the RNAi agent is administered at a dose of about 0.001 mg/kg to about 0.500 mg/kg of body weight. 
     
     
         54 . The method of  claim 53 , wherein the RNAi agent is administered in two or more doses.