Biomarkers for Cervical Cancer

Abstract

The invention relates to methods, reagents and kits for detecting the susceptibility to cervical cancer. In particular, it relates to novel methylation markers to improve screening for cervical intraepithelial neoplasia grade 2/3 (CIN2/3) and the use thereof for identifying a cervical cell as neoplastic or predisposed to neoplasia in an isolated sample.

1 . A kit for use in identifying a cervical cell as neoplastic or predisposed to neoplasia in an isolated sample, the kit comprising:
 methylation specific PCR primers complementary to marker gene C13ORF18,   methylation specific PCR primers complementary to marker gene ANKRD18CP,   a gene specific probe for marker gene C13ORF18, and   a gene specific probe for marker gene ANKRD18CP.   
     
     
         2 . The kit of  claim 1 , further comprising an Ayre's spatula and/or an endocervical brush for removing cervical cells from a subject. 
     
     
         3 . The kit of  claim 1 , wherein the methylation specific PCR primers complementary to marker gene ANKRD18CP comprise a first primer comprising sequence CGATGTGGTATTTTCGATTC (SEQ ID NO: 5) and a second primer comprising sequence ACGTGTAAAAAATCGCCAC (SEQ ID NO: 6). 
     
     
         4 . The kit of  claim 1 , wherein the gene specific probe for marker gene ANKRD18CP comprises sequence AGGAGCGTTTGGTTTAGGCGTTTTTCG (SEQ ID NO: 19). 
     
     
         5 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene ZSCAN1 and a gene specific probe for marker gene ZSCAN1. 
     
     
         6 . The kit of  claim 5 , wherein the methylation specific PCR primers complementary to marker gene ZSCAN1 comprise a first primer comprising sequence TTGTTGGTATTCGTTTGTTC (SEQ ID NO: 1) and a second primer comprising sequence ACGCGACCGAACGATATT (SEQ ID NO: 2). 
     
     
         7 . The kit of  claim 5 , wherein the gene specific probe for marker gene ZSCAN1 comprises sequence AGGTCGAAGTTTTTTTACGTATTTTTATTGTTCGTTTA (SEQ ID NO: 17). 
     
     
         8 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene EPB41L3 and a gene specific probe for marker gene EPB41L3. 
     
     
         9 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene JAM3 and a gene specific probe for marker gene JAM3. 
     
     
         10 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene KCNIP4 and a gene specific probe for marker gene KCNIP4. 
     
     
         11 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene GFRA1 and a gene specific probe for marker gene GFRA1. 
     
     
         12 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene ST6GALNAC5 and a gene specific probe for marker gene ST6GALNAC5. 
     
     
         13 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene CDH6 and a gene specific probe for marker gene CDH6. 
     
     
         14 . The kit of  claim 1 , further comprising methylation specific PCR primers complementary to marker gene LHX8 and a gene specific probe for marker gene LHX8.