Compositions and methods for inhibiting expression of the alas1 gene

Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.

1 . A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucleotides from the antisense sequence of 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 4153) 
                 
                     
                   UAAGAUGAGACACUCUUUCUGGU 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 4154) 
                 
                     
                   UAAGAUGAGACACUCTUUCUGGU. 
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
         2 . A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40, or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 (SEQ ID NOs: 4172 to 5237). 
     
     
         3 . The dsRNA of  claim 1 , wherein said dsRNA comprises at least one modified nucleotide. 
     
     
         4 . The dsRNA of  claim 1 , wherein the dsRNA comprises a duplex region which is 17-23 nucleotide pairs in length. 
     
     
         5 . The dsRNA of  claim 1 , wherein at least one strand comprises a 3′ overhang of at least 2 nucleotides. 
     
     
         6 . The dsRNA of  claim 1 , wherein each strand is no more than 26 nucleotides in length. 
     
     
         7 . The dsRNA of  claim 3 , wherein at least one modified nucleotide is chosen from a 2′-O-methyl, a 2′-fluoro modified nucleotide, and optionally one or more 5′-phosphorothioate groups, or any combination thereof. 
     
     
         8 . The dsRNA of  claim 1 , further comprising a ligand, optionally wherein the ligand is conjugated to the 3′ end of the sense strand of the dsRNA. 
     
     
         9 . The dsRNA of  claim 8 , wherein the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand. 
     
     
         10 . The dsRNA of  claim 9 , wherein the ligand is 
       
         
           
           
               
               
           
         
       
     
     
         11 .- 17 . (canceled) 
     
     
         18 . The dsRNA of  claim 1 , wherein the dsRNA shows improved activity compared with a dsRNA having a sense strand comprising the sequence of SEQ ID NO: 4149 and an antisense strand comprising the sequence of SEQ ID NO: 4150 or a dsRNA having a sense strand comprising the sequence of SEQ ID NO: 4151 and an antisense strand comprising the sequence of SEQ ID NO: 4152, optionally wherein the dsRNA is selected from the dsRNAs listed in Tables 21 to 40. 
     
     
         19 . The dsRNA of  claim 1 , wherein the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). 
     
     
         20 . The dsRNA of  claim 1 , wherein:
 (i) the antisense strand comprises the sequence of SEQ ID NO: 4161;   (ii) the antisense strand consists of the sequence of SEQ ID NO: 4161;   (iii) the sense strand comprises the sequence of SEQ ID NO: 4160;   (iv) the sense strand consists of the sequence of SEQ ID NO: 4160;   (v) the sense strand comprises the sequence of SEQ ID NO: 4160, and the antisense strand comprises the sequence of SEQ ID NO: 4161; or   (vi) the sense strand consists of the sequence of SEQ ID NO: 4160, and the antisense strand consists of the sequence of SEQ ID NO: 4161.   
     
     
         21 . The dsRNA of  claim 1 , wherein:
 (i) the antisense strand comprises the sequence of SEQ ID NO: 4157, and/or the sense strand comprises the sequence of SEQ ID NO: 4156, or   (ii) the antisense strand consists of the sequence of SEQ ID NO: 4157, and/or the sense strand consists of the sequence of SEQ ID NO: 4156.   
     
     
         22 . The dsRNA of  claim 1 , wherein:
 (i) the antisense strand comprises the sequence of SEQ ID NO: 4165, and/or the sense strand comprises the sequence of SEQ ID NO: 4164, or   (ii) the antisense strand consists of the sequence of SEQ ID NO: 4165, and/or the sense strand consists of the sequence of SEQ ID NO: 4164.   
     
     
         23 . The dsRNA of  claim 2 , wherein:
 (i) the antisense strand comprises the sequence of SEQ ID NO: 4169, the sense strand comprises the sequence of SEQ ID NO: 4168, or   (ii) the antisense strand consists of the sequence of SEQ ID NO: 4169, and/or the sense strand consists of the sequence of SEQ ID NO: 4168.   
     
     
         24 . A vector encoding at least one strand of a dsRNA of  claim 1 . 
     
     
         25 . A cell comprising the dsRNA of  claim 1 . 
     
     
         26 . A pharmaceutical composition for inhibiting expression of an ALAS1 gene, the composition comprising the dsRNA of  claim 1 . 
     
     
         27 .- 28 . (canceled) 
     
     
         29 . A method of inhibiting ALAS1 expression in a cell, the method comprising:
 (a) introducing into the cell the dsRNA of  claim 1 , and   (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell, optionally wherein the expression of ALAS1 is inhibited by at least 20% or at least 30%.   
     
     
         30 . A method for decreasing a level of a porphyrin or a porphyrin precursor in a cell, comprising contacting the cell with the dsRNA of of  claim 1 , in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell. 
     
     
         31 . A method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of
 the dsRNA of  claim 1 ,   thereby treating the porphyria, wherein the subject is at risk for developing, or is diagnosed with, a porphyria.   
     
     
         32 . (canceled) 
     
     
         33 . The method of  claim 31 , wherein the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria. 
     
     
         34 . The method of  claim 31 , wherein (i) the dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA is administered prophylactically to prevent an acute attack of porphyria. 
     
     
         35 . The method of  claim 31 , wherein the dsRNA is administered at a dose of 0.05 to 50 mg/kg or 0.01 mg/kg to 5 mg/kg bodyweight of the subject, or at a dose of 1 mg/kg, 2.5 mg/kg, or 5 mg/kg bodyweight of the subject. 
     
     
         36 . The method of  claim 31 , wherein the method
 (i) decreases a level of a porphyrin or a porphyrin precursor in the subject, optionally wherein the level is decreased by at least 30% and/or   (ii) inhibits ALAS1 expression in the subject.   
     
     
         37 . The method of  claim 31 , wherein said method (i) ameliorates a symptom associated with an ALAS1 related disorder, (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor. 
     
     
         38 . The method of  claim 31 , wherein the dsRNA is administered according to a dosing regimen, e.g., weekly, biweekly, or monthly. 
     
     
         39 . (canceled) 
     
     
         40 . The method of  claim 31 , wherein the subject has an elevated level of ALA and/or PBG and optionally wherein the subject suffers from chronic pain. 
     
     
         41 . (canceled) 
     
     
         42 . The method of  claim 31 , wherein the method decreases or prevents pain, neuropathy, and/or nerve damage. 
     
     
         43 .- 47 . (canceled) 
     
     
         48 . A method for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising:
 detecting the level of ALAS1 mRNA in a biological fluid sample from the subject, said biological fluid sample comprising the ALAS1 mRNA,   thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.   
     
     
         49 . The method of  claim 48  comprising
 (i) providing RNA from a biological fluid sample from the subject, said biological fluid sample is chosen from a blood sample, a plasma sample, a serum sample, or a urine sample, and comprises the ALAS1 mRNA; 
 (ii) obtaining an ALAS1 cDNA from the ALAS1 mRNA; 
 (iii) contacting the ALAS1 cDNA with a nucleic acid complementary to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mix; and 
 (iv) detecting the level of ALAS1 cDNA in the reaction mix, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level, 
 
       thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject, optionally wherein 
       (a) the method comprises PCR, qPCR or 5′-RACE, 
       (b) the nucleic acid is a probe or primer, and/or 
       (c) the nucleic acid comprises a detectable moiety and the level of ALAS1 mRNA is determined by detection of the amount of the detectable moiety. 
     
     
         50 .- 53 . (canceled) 
     
     
         54 . The pharmaceutical composition of  claim 26 , comprising about 200 mg/mL of the dsRNA. 
     
     
         55 . The pharmaceutical composition of claim  53 , wherein the composition has a pH of 6.0-7.5. 
     
     
         56 .- 59 . (canceled) 
     
     
         60 . The dsRNA of  claim 1 , wherein the ALAS1 RNA transcript comprises the sequence of SEQ ID NO: 1. 
     
     
         61 . The dsRNA of  claim 1 , wherein the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following:
 (i) is chemically synthesized;   (ii) all the nucleotides in the dsRNA are modified;   (iii) all nucleotides are connected through 3′-5′ phosphodiester linkages;   (iv) the sense strand comprises or consists of 21 nucleotides;   (v) the antisense sense strand comprises or consists of 23 nucleotides;   (vi) has a blunt-end at the 3′-end of sense strand;   (vii) has a 3′-overhang;   (viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;   (ix) the 3′-end of the sense strand is conjugated to the triantennary GalNAc moiety;   (x) has an antisense strand that comprises one or more phosphorothioate linkages;   (xi) has a sense strand that comprises one or more phosphorothioate linkages;   (xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;   (xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3′-end of the antisense strand;   (xiv) comprises, or consists of, a sense strand having the sequence of SEQ ID NO: 4160 or 4162 and an antisense strand having the sequence of SEQ ID NO: 4161 or 4163;   (xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4160;   (xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4161; or   (xvii) has a sense strand having the sequence of SEQ ID NO: 4160 and an antisense strand having the sequence of SEQ ID NO: 4161.