Adeno-Associated Viral (AAV) Vectors for Tissue-Targeted Expression of Therapeutic Genes

Abstract

Described herein are compositions and methods for tissue-targeted expression of therapeutic genes, using AAV expression vectors that reduce the risk of toxicity associated with AAV gene therapy in the CNS by de-targeting the vulnerable neurons cells including the DRG cells on gene expression, and de-targeting the liver, a major suspect for over-expression in the periphery.

What is claimed is: 
     
         1 . An adeno-associated virus (AAV) vector, preferably comprising a target tissue-tropic capsid, optionally AAV.CPP.16, AAV.CPP.21 or AAV9, and further comprising an expression cassette comprising, preferably from 5′ to 3′:
 a promoter that drives expression in cells of the target tissue, 
 an optional secretory signal peptide sequence, 
 a coding sequence for a protein of interest, 
 an optional Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), 
 a polyA signal sequence, and 
 at least one microRNA targeting sequence selected from a microRNA 122 targeting sequence (miR-122T), optionally targeting the 5p strand, optionally comprising CAAACACCATTGTCACACTCCA (SEQ ID NO: 21); a microRNA 124 targeting sequence (miR-124T), optionally targeting the 5p strand, optionally comprising ATCAAGGTCCGCTGTGAACACG (SEQ ID NO: 20); a microRNA 200c targeting sequence (miR-200cT), optionally targeting the 5p strand, optionally CCAAACACTGCTGGGTAAGACG (SEQ ID NO: 22); and/or microRNA 1 targeting sequence (miR-1T), optionally targeting the 5p strand, optionally ATGGGCATATAAAGAAGTATGT (SEQ ID NO: 24), at the 3′ UTR. 
 
     
     
         2 . The AAV vector of  claim 1 , wherein the capsid is CNS tropic, optionally neuronal or glial-tropic. 
     
     
         3 . The AAV vector of  claim 2 , wherein the promoter that drives expression in the CNS drives expression in neuronal cells or glial cells. 
     
     
         4 . The AAV vector of  claim 3 , wherein the promoter that drives expression in glial cells is a GFAP promoter, gfaABC1D promoter, gfa2 promoter, ALDH1L1 promoter, SLC1A3 promoter, Gjb6 promoter, Mbp promoter, MAG promoter, CBh promoter, F4/80 promoter, CD68 promoter, or CD11B promoter. 
     
     
         5 . The AAV vector of  claim 3 , wherein the promoter that drives expression in neuronal cells is a neuronal-specific enolase (NSE) promoter, Synapsin promoter, calcium/calmodulin-dependent protein kinase II promoter, tubulin alpha 1 promoter, platelet-derived growth factor beta chain promoter, parvalbumin promoter, GAD67 promoter or CCK promoter. 
     
     
         6 . The AAV vector of  claim 1 , wherein the promoter is a ubiquitous promoter, optionally major immediate early human cytomegalovirus promoter (MIEhCMV), Chicken (3-Actin Promoter (CBA); Human Cytomegalovirus Immediate/Early Gene Promoter and Enhancer (CMV); Chicken 3-Actin/Cytomegalovirus Hybrid Promoter (CAG); Rous Sarcoma Virus Long Terminal Repeat Promoter (RSV); SV40 promoter; EF 1 alpha promoter. 
     
     
         7 . The AAV vector of  claim 1 , further comprising an enhancer, optionally CMV-Enhancer, mD1x enhancer, AQP4 enhancer. 
     
     
         8 . The AAV vector of  claim 1 , wherein the optional secretory signal peptide sequence is a Human IL-2 signal peptide (optionally MYRMQLLSCIALSLALVTNS, SEQ ID NO: 16), human albumin signal peptide, human alpha 1-antitrypsin signal peptide, or human factor VIII signal peptide. 
     
     
         9 . The AAV vector of  claim 1 , wherein the polyA signal sequence is from human growth hormone (hGH), SV40, bovine growth hormone (bGH), or beta-globin, optionally rabbit beta-globin (rbGlob). 
     
     
         10 . The AAV vector of  claim 1 , comprising a plurality of, optionally 2-10 or 3-5, microRNA targeting sequences, optionally separated by spacer sequence (optionally of 1-50 nucleotides). 
     
     
         11 . The AAV vector of  claim 1 , wherein the protein of interest is a therapeutic protein. 
     
     
         12 . The AAV vector of  claim 11 , wherein the therapeutic protein of interest is an antibody such as immune checkpoint inhibitors. 
     
     
         13 . The AAV vector of  claim 11 , wherein the therapeutic protein of interest is a toxin, a suicide protein, or an antibody. 
     
     
         14 . The AAV vector of  claim 13 , wherein the toxin is diphtheria toxin, tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), or TNF-α. 
     
     
         15 . The AAV vector of  claim 14 , wherein the suicide protein is herpes simplex virus thymidine kinase (HSVTK), bacterial or fungal cytosine deaminase (CD), carboxypeptidase G2 (CPG2), nitroreductase (NTR), Cytochrome P450 (CYP), purine nucleoside phosphorylase (PNP), horseradish peroxidase (HRP), or carboxylesterase (CE). 
     
     
         16 . The AAV Vector of  claim 1 , which targets the CNS; wherein the capsid is AAV.CPP.16 or AAV.CPP.21; the promoter is a GFAP promoter or a Syn promoter; and the microRNA targeting sequences target one, two, or all three of microRNA 122, microRNA 200c and microRNA 1. 
     
     
         17 . The AAV vector of  claim 16 , wherein the protein of interest is MeCP2, CNTF, or NGF. 
     
     
         18 . The AAV Vector of  claim 1 , which targets the liver; wherein the capsid is AAV.CPP.16 or AAV9; the promoter is a LSP promoter or an α1-antitrypsin promoter; the microRNA targeting sequences target one, two, or all three of microRNA 124, microRNA 200c and microRNA 1. 
     
     
         19 . The AAV vector of  claim 18 , wherein the protein of interest is Factor VIII or factor IX. 
     
     
         20 . The AAV Vector of  claim 1 , which targets the heart or other muscle; wherein the capsid is AAV.CPP.16; the promoter is a MLC2v promoter or MCK promoter; and the microRNA targeting sequences target one, two, or all three of microRNA 122, microRNA 200c and microRNA 124. 
     
     
         21 . The AAV vector of  claim 20 , wherein the protein of interest is mini dystrophin or factor IX. 
     
     
         22 . The AAV Vector of  claim 1 , which targets the lung, wherein the capsid is AAV.CPP.16; the promoter is an SP-B promoter or SP-C promoter; and the microRNA targeting sequences target one, two, or all three of microRNA 122, microRNA 124 and microRNA 1. 
     
     
         23 . The AAV vector of  claim 22 , wherein the protein of interest is Alpha-1 antitrypsin or an anti-SARS antibody. 
     
     
         24 . A method of directing expression of a protein of interest in a cell in a target tissue, preferably without substantial expression of the protein of interest in non-target cells, the method comprising introducing the AAV vector of  claim 1  into the cell. 
     
     
         25 . A method of inducing cell death in cell in a glial cell or a neuronal cell, the method comprising introducing the AAV vector of  claim 1  into the cell. 
     
     
         26 . The method of  claim 25 , wherein the therapeutic protein of interest is a suicide protein, and the method further comprises contact the cell with a nontoxic prodrug that is a substrate for the suicide protein, wherein action of the suicide protein on the nontoxic prodrug results in production of a toxic metabolite that induces cell death. 
     
     
         27 . The method of  claim 26 , wherein the suicide protein is herpes simplex virus thymidine kinase (HSVTK) and the nontoxic prodrug is ganciclovir (GCV); the suicide protein is cytosine deaminase (CD) and the nontoxic prodrug is 5-flourouracil (5-FU); the suicide protein is carboxypeptidase G2 (CPG2) and the nontoxic prodrug is nitrogen mustard (NM) or a derivate thereof such as ZD2767P or CMDA (4-[(2-chloroethyl)(2-mesyloxyethyl)amino]benzoyl-L-glutamicacid); the suicide protein is nitroreductase (NTR) and the nontoxic prodrug is CB1954 or an analog thereof; the suicide protein is Cytochrome P450 (CYP) and the nontoxic prodrug is an oxazaphosphorine drug such as cyclophosphamide (CPA) and ifosfomide (IFO); the suicide protein is purine nucleoside phosphorylase (PNP) and the nontoxic prodrug is 6-Methylpurine Deoxyriboside or an analog thereof, optionally fludarabine phosphate (F-araAMP) or 2-fluoro-2-deoxyadenosine (F-dAdo); the suicide gene is horseradish peroxidase (HRP) and the nontoxic prodrug is indole-3-acetic acid (HRP/IAA); or the suicide protein is carboxylesterase (CE) and the nontoxic prodrug is irinotecan. 
     
     
         28 . The method of  claim 25 , wherein the glial cell is a cancer cell in a subject. 
     
     
         29 . The method of  claim 28 , wherein the cancer is glioblastoma.