Methods and tools for analysing the duchenne muscular dystrophy (dmd) gene
Abstract
An aspect of the invention provides a method for analysing the Duchenne Muscular Dystrophy (DMD) gene in a sample containing genetic material of a subject, wherein the method detects the presence or absence of at least exons 7, 43, 44, 45, 46, 49, 50, 51, 52 and 54 of the DMD gene in the genetic material of the subject, wherein the detection of the presence or absence of the exons comprises multiplex polymerase-based nucleic acid amplification. Another aspect of the invention provides a method for analysing the DMD gene in a sample containing genetic material of a subject, wherein the method detects the presence or absence of at least exons 7, 43, 44, 45, 46, 49, 50, 51, 52 and 54 of the DMD gene in the genetic material of the subject, and wherein the sample is blood. Additional aspects of the invention provide tools applicable in the disclosed methods, such as primers, primer pairs, primer pair sets, oligonucleotide probes and probe sets, as well as compositions and kits containing the same.
Claims
exact text as granted — not AI-modified1 . A method for analysing the Duchenne Muscular Dystrophy (DMD) gene in a sample containing genetic material of a subject, wherein the method detects the presence or absence of at least exons 44, 46, 50, 52 and 54 of the DMD gene in the genetic material of the subject, wherein the detection of the presence or absence of the exons comprises multiplex polymerase-based nucleic acid amplification;
wherein the polymerase-based nucleic acid amplification is configured to amplify: a) to detect the presence or absence of exon 44 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence GATCTGTCAAATCGCCTGCAGGTAAAAGC (SEQ ID NO: 1) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 2)
TTCTTAAAGATCAGGTTCTGAAGGGTGATGGA;
b) to detect the presence or absence of exon 46 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence TGTTATCTGCTTCCTCCAACCATAAAACAAA (SEQ ID NO: 3) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 4)
TTCAATCATTGGTTTTCTGCCCATTAGGTT;
c) to detect the presence or absence of exon 50 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence AAACGGTTTACCGCCTTCCACTCAGAGCTC (SEQ ID NO: 5) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 6)
AACTATGAAGTGATGACTGGGTGAGAGAGAA;
d) to detect the presence or absence of exon 52 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence TATCAGGGTTCTTCAGCGTTGTGTATTCCTTT (SEQ ID NO: 7) and an amplification primer configured to hybridise within the nucleic acid sequence TTTTTAACAAGCATGGGACACACAAAGCAA (SEQ ID NO: 8); and
e) to detect the presence or absence of exon 54 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence CGGAGGTCTTTGGCCAACTGCTATAGATTTTT (SEQ ID NO: 9) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 10)
GGTGGTGAAACTGGATGGACCATGAGGATT;
wherein the sample is dried blood; and
wherein the subject is a neonate.
2 . The method according to claim 1 , wherein the multiplex polymerase-based nucleic acid amplification is multiplex polymerase chain reaction (PCR).
3 . The method according to claim 1 , wherein the multiplex polymerase-based nucleic acid amplification is multiplex real-time quantitative amplification, preferably multiplex real-time quantitative PCR (qPCR).
4 . The method according to claim 1 , wherein the detection of the presence or absence of at least exons 44, 46, 50, 52 and 54 of the DMD gene in the genetic material of the subject is multiplexed in a single polymerase-based nucleic acid amplification reaction.
5 . The method according to claim 1 , wherein the polymerase-based nucleic acid amplification is configured to amplify:
a) to detect the presence or absence of exon 44 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TACCTGCAGGCGATTTGAC (SEQ ID NO: 11) or of a sequence diverging from SEQ ID NO: 11 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 11; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CACCCTTCAGAACCTGATCTTT (SEQ ID NO: 12) or of a sequence diverging from SEQ ID NO: 12 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 12; b) to detect the presence or absence of exon 46 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TTTATGGTTGGAGGAAGCAGA (SEQ ID NO: 13) or of a sequence diverging from SEQ ID NO: 13 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 13; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AATGGGCAGAAAACCAATGA (SEQ ID NO: 14) of a sequence or diverging from SEQ ID NO: 14 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 14; c) to detect the presence or absence of exon 50 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CTGAGTGGAAGGCGGTAAAC (SEQ ID NO: 15) or of a sequence diverging from SEQ ID NO: 15 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 15; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TCTCACCCAGTCATCACTTCA (SEQ ID NO: 16) or of a sequence diverging from SEQ ID NO: 16 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 16; d) to detect the presence or absence of exon 52 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AATACACAACGCTGAAGAACCC (SEQ ID NO: 17) or of a sequence diverging from SEQ ID NO: 17 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 17; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TTGTGTGTCCCATGCTTGTT (SEQ ID NO: 18) or of a sequence diverging from SEQ ID NO: 18 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 18; and e) to detect the presence or absence of exon 54 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TCTATAGCAGTTGGCCAAAGAC (SEQ ID NO: 19) or of a sequence diverging from SEQ ID NO: 19 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 19; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TCATGGTCCATCCAGTTTCA (SEQ ID NO: 20) or of a sequence diverging from SEQ ID NO: 20 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 20.
6 . The method according to claim 1 , wherein the polymerase-based nucleic acid amplification is configured to amplify:
a) to detect the presence or absence of exon 44 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 11 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 12; b) to detect the presence or absence of exon 46 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 13 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 14; c) to detect the presence or absence of exon 50 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 15 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 16; d) to detect the presence or absence of exon 52 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 17 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 18; and e) to detect the presence or absence of exon 54 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 19 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 20.
7 . The method according to claim 1 , wherein the amplified target nucleic acid regions are detected by oligonucleotide probes configured to hybridise with said target nucleic acid regions, preferably wherein the oligonucleotide probes comprise detectable labels allowing for individual detection of each of the amplified target nucleic acid regions, more preferably wherein the detectable labels comprise distinct fluorophores having distinct excitation and/or emission characteristics, such that each of the amplified target nucleic acid regions can be individually detected by detecting the corresponding fluorophore.
8 . The method according to claim 1 , wherein:
a) to detect the presence or absence of exon 44 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 21)
TTTAGCATGTTCCCAATTCTCAGGAATTTGTGTC;
b) to detect the presence or absence of exon 46 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 22)
CTTTTAGTTGCTGCTCTTTTCCAGGTTCAAGT;
c) to detect the presence or absence of exon 50 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 23)
GGCTGCTTTGCCCTCAGCTCTTGAAGTAAACG;
d) to detect the presence or absence of exon 52 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 24)
TCTTGTTTTTCAAATTTTGGGCAGCGGTAAT;
e) to detect the presence or absence of exon 54 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 25)
TGAATGCTTCTCCAAGAGGCATTGATATTCTCTG.
9 . The method according to claim 1 , wherein:
a) to detect the presence or absence of exon 44 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AAATTCCTGAGAATTGGGAACATG (SEQ ID NO: 26) or of a sequence diverging from SEQ ID NO: 26 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 26, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 26; b) to detect the presence or absence of exon 46 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AACCTGGAAAAGAGCAGCAACT (SEQ ID NO: 27) or of a sequence diverging from SEQ ID NO: 27 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 27, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 27; c) to detect the presence or absence of exon 50 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence ACTTCAAGAGCTGAGGGCAAAG (SEQ ID NO: 28) or of a sequence diverging from SEQ ID NO: 28 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 28, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 28; d) to detect the presence or absence of exon 52 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CGCTGCCCAAAATTTGAAAAA (SEQ ID NO: 29) or of a sequence diverging from SEQ ID NO: 29 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 29, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 29; and e) to detect the presence or absence of exon 54 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AATATCAATGCCTCTTGGAGAAGC (SEQ ID NO: 30) or of a sequence diverging from SEQ ID NO: 30 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 30, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 30.
10 . The method according to claim 1 , wherein the subject is a mammal, preferably a human.
11 . The method according to claim 1 , wherein the sample is a dried blood spot.
12 . A set of amplification primer pairs suitable for polymerase-based nucleic acid amplification, comprising an amplification primer pair configured to detect the presence or absence of exon 44 of the DMD gene, an amplification primer pair configured to detect the presence or absence of exon 46 of the DMD gene, an amplification primer pair configured to detect the presence or absence of exon 50 of the DMD gene, and an amplification primer pair configured to detect the presence or absence of exon 52 of the DMD gene, and an amplification primer pair configured to detect the presence or absence of exon 54 of the DMD gene, wherein the respective amplification primer pairs are as defined in any one of claim 1 , 5 or 6 .
13 . The set of amplification primer pairs according to claim 12 , further comprising a set of oligonucleotide probes configured to hybridise with the target nucleic acid regions, preferably wherein the respective oligonucleotide probes are as defined in any one of claims 7 to 9 and 22 .
14 . A set of oligonucleotide probes, wherein the respective oligonucleotide probes are as defined in any one of claims 7 to 9 and 22 .
15 . A composition comprising the set of amplification primer pairs and/or the set of oligonucleotide probes according to any one of claims 12 to 14 and 23 .
16 . A kit of parts comprising the set of amplification primer pairs and/or the set of oligonucleotide probes according to any one of claims 10 to 14 and 23 , and optionally further comprising reagents sufficient for formulating a polymerase-based nucleic acid amplification reaction mixture.
17 . The method according to claim 1 , wherein the method further comprises detecting the presence or absence of exons 7, 43, 45, 49 and 51 of the DMD gene in the genetic material of the subject, and
wherein the polymerase-based nucleic acid amplification is further configured to amplify: f) to detect the presence or absence of exon 7 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence AAATAGGTCTGGCCTAAAACACATACACATAC (SEQ ID NO: 36) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 37)
GATCCTGAAGGTTGGTAAATTTCTGGACTACC;
g) to detect the presence or absence of exon 43 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence ATAATGTCAATCCGACCTGAGCTTTGTTGT (SEQ ID NO: 38) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 39)
TGTACAAGGACCGACAAGGGTAGGTAACAC;
h) to detect the presence or absence of exon 45 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence CTGGAGTTCCTGTAAGATACCAAAAAGGCAAAAC (SEQ ID NO: 40) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 41)
CTACAGGAAAAATTGGGAAGCCTGAATCT;
i) to detect the presence or absence of exon 49 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence TGCTATTTCAGTTTCCTGGGGAAAAGAACC(SEQ ID NO: 42) and an amplification primer configured to hybridise within the nucleic acid sequence TCTAGCAATATCCATTACCTCATAATGGGTTATG (SEQ ID NO: 43); and
j) to detect the presence or absence of exon 51 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer configured to hybridise within the nucleic acid sequence CCACAGGTTGTGTCACCAGAGTAACAGTCTGAGT (SEQ ID NO: 44) and an amplification primer configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 45)
TTATAAAATCACAGAGGGTGATGGTGGGTGA.
18 . The method according to claim 1 , wherein the detection of the presence or absence of at least exons 7, 43, 44, 45, 46, 49, 50, 51, 52 and 54 of the DMD gene in the genetic material of the subject is multiplexed in a single polymerase-based nucleic acid amplification reaction.
19 . The method according to claim 17 , wherein the polymerase-based nucleic acid amplification is further configured to amplify:
f) to detect the presence or absence of exon 7 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TGTATGTGTTTTAGGCCAGACC (SEQ ID NO: 46) or of a sequence diverging from SEQ ID NO: 46 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 46; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TCCAGAAATTTACCAACCTTCA (SEQ ID NO: 47) or of a sequence diverging from SEQ ID NO: 47 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 47; g) to detect the presence or absence of exon 43 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AAAGCTCAGGTCGGATTGAC (SEQ ID NO: 48) or of a sequence diverging from SEQ ID NO: 48 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 48; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence ACCTACCCTTGTCGGTCCTT (SEQ ID NO: 49) or of a sequence diverging from SEQ ID NO: 49 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 49; h) to detect the presence or absence of exon 45 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence GCCTTTTTGGTATCTTACAGGAAC (SEQ ID NO: 50) or of a sequence diverging from SEQ ID NO: 50 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 50; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CAGGCTTCCCAATTTTTCC (SEQ ID NO: 51) or of a sequence diverging from SEQ ID NO: 51 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 51; i) to detect the presence or absence of exon 49 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TTTTCCCCAGGAAACTGAAA (SEQ ID NO: 52) or of a sequence diverging from SEQ ID NO: 52 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 52; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CCCATTATGAGGTAATGGATATTG (SEQ ID NO: 53) or of a sequence diverging from SEQ ID NO: 53 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 53; and j) to detect the presence or absence of exon 51 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising: an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence GACTGTTACTCTGGTGACACAACC (SEQ ID NO: 54) or of a sequence diverging from SEQ ID NO: 54 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 54; and an amplification primer comprising at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CACCATCACCCTCTGTGATTT (SEQ ID NO: 55) or of a sequence diverging from SEQ ID NO: 55 by addition, deletion or substitution of one or two nucleotides, or comprising or consisting of SEQ ID NO: 55.
20 . The method according to claim 17 , wherein the polymerase-based nucleic acid amplification is further configured to amplify:
f) to detect the presence or absence of exon 7 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 46 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 47; g) to detect the presence or absence of exon 43 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 48 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 49; h) to detect the presence or absence of exon 45 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 50 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 51; i) to detect the presence or absence of exon 49 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 52 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 53; and j) to detect the presence or absence of exon 51 of the DMD gene, a target nucleic acid region using an amplification primer pair comprising an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 54 and an amplification primer of nucleic acid sequence as set forth in SEQ ID NO: 55.
21 . The method according to claim 17 , wherein:
f) to detect the presence or absence of exon 7 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 56)
TGACTGCTGGCAAACCACACTATTCCAGTCAA;
g) to detect the presence or absence of exon 43 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 57)
TTTTTCCCATTGGAAATCAAGCTGGGAGAG;
h) to detect the presence or absence of exon 45 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 58)
TCTTCCCCAGTTGCATTCAATGTTCTGACAAC;
i) to detect the presence or absence of exon 49 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 59)
TTAGACAAAATCTCTTCCACATCCGGTTGTTTA;
j) to detect the presence or absence of exon 51 of the DMD gene, the oligonucleotide probe is configured to hybridise within the nucleic acid sequence
(SEQ ID NO: 60)
CCAGTCGGTAAGTTCTGTCCAAGCCCGGTTG.
22 . The method according to claim 17 , wherein:
f) to detect the presence or absence of exon 7 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence TGGAATAGTGTGGTTTGCCAGC (SEQ ID NO: 61) or of a sequence diverging from SEQ ID NO: 61 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 61, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 61; g) to detect the presence or absence of exon 43 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CCAGCTTGATTTCCAATGGG (SEQ ID NO: 62) or of a sequence diverging from SEQ ID NO: 62 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 62, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 62; h) to detect the presence or absence of exon 45 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence CAGAACATTGAATGCAACTGGG (SEQ ID NO: 63) or of a sequence diverging from SEQ ID NO: 63 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 63, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 63; i) to detect the presence or absence of exon 49 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence AACCGGATGTGGAAGAGATTTTG (SEQ ID NO: 64) or of a sequence diverging from SEQ ID NO: 64 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 64, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 64; and j) to detect the presence or absence of exon 51 of the DMD gene, the oligonucleotide probe comprises at least 12 contiguous nucleotides, preferably at least 15 contiguous nucleotides, more preferably at least 18 contiguous nucleotides of the nucleic acid sequence GGGCTTGGACAGAACTTACCG (SEQ ID NO: 65) or of a sequence diverging from SEQ ID NO: 65 by addition, deletion or substitution of one or two nucleotides, or comprises or consists of SEQ ID NO: 65, preferably the oligonucleotide probe is of nucleic acid sequence as set forth in SEQ ID NO: 65.
23 . The set of amplification primer pairs according to claim 12 , further comprising an amplification primer pair configured to detect the presence or absence of exon 7 of the DMD gene, an amplification primer pair configured to detect the presence or absence of exon 43 of the DMD gene, an amplification primer pair configured to detect the presence or absence of exon 45 of the DMD gene, an amplification primer pair configured to detect the presence or absence of exon 49 of the DMD gene, an amplification primer pair configured to detect the presence or absence of exon 51 of the DMD gene, wherein the respective amplification primer pairs are as defined in any one of claim 17 , 19 or 20 .Join the waitlist — get patent alerts
Track US2023109870A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.