Methods and means for efficient dkipping of exon 45 in duchenne muscular dystrophy pre-mrna

Abstract

The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing said cell with an antisense molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such antisense molecule used in said method.

1 . A molecule that binds to a continuous stretch of at least 21 nucleotides within exon 45 of DMD pre-mRNA, wherein the molecule comprises or consists of a 2′-O-alkyl phosphorothioate antisense oligonucleotide sequence selected from SEQ ID NOS: 9-67. 
     
     
         2 . The molecule according to  claim 1 , whereby said molecule binds to a continuous stretch of at least 25 nucleotides within said exon. 
     
     
         3 . The molecule according to  claim 1 , whereby said molecule comprises an antisense oligonucleotide of between 21 and 30 bases. 
     
     
         4 . The molecule according to  claim 1 , whereby said molecule comprises an antisense oligonucleotide of 25 bases. 
     
     
         5 . The molecule according to  claim 1 , whereby said molecule binds to a continuous stretch of at least 21 nucleotides within the following nucleotide sequence:
 5′ - CCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGA ACAUUGAAUGCAACUGGGGAAGAAAUAAUUCAGCAAUC - 3′ (SEQ ID NO: 2).   
     
     
         6 . The molecule according to  claim 1 , comprising a 2′-O-methyl phosphorothioate ribose. 
     
     
         7 . A viral-based vector, comprising an expression cassette that drives expression of the molecule as defined in  claim 1 . 
     
     
         8 . A pharmaceutical composition comprising the molecule as defined in  claim 1 , a pharmaceutically acceptable carrier, and optionally a molecule having a base sequence selected from the base sequence of SEQ ID NOS:69-236 which is able to induce or promote skipping of exon 7, 44, 46, 51, 53, 59, or 67 of the DMD pre-mRNA of a patient. 
     
     
         9 . A method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a patient, the method comprising providing said patient with the molecule of  claim 1 . 
     
     
         10 . The method according to  claim 9 , wherein the patient is provided with a functional dystrophin protein and/or wherein the production of an aberrant dystrophin protein in said patient is decreased, wherein the level of said functional dystrophin is assessed by comparison to the level of said dystrophin in said patient at the onset of the method.