US2023183752A1PendingUtilityA1
Complexes for gene deletion and editing
Est. expiryJan 9, 2037(~10.4 yrs left)· nominal 20-yr term from priority
A01K 2207/12A61P 3/04C07K 7/06C12N 9/96C07K 14/4702C12N 2310/16C07K 14/003C07K 7/08C12N 2310/14A61K 47/549C07K 19/00A01K 2217/07A01K 2227/105C12N 2320/32C12N 15/113C07K 14/00C12N 15/907C12N 2310/3513A61K 47/64C12N 9/22C12N 5/0653A01K 67/0278A61K 9/0019A01K 2267/0362C12N 2310/20
65
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Complexes comprising a nucleic acid-guided endonuclease, a sequence-specific targeting nucleic acid and an amphipathic helical peptide are provided. Compositions and methods for delivery of complexes comprising a nucleic acid-guided endonuclease, a sequence-specific targeting nucleic acid and an amphipathic helical peptide to mammals for both research and therapeutic use are provided. Methods of treating or reducing one or more symptoms of type 2 diabetes, prediabetes and/or gestational diabetes are provided.
Claims
exact text as granted — not AI-modified1 . A composition comprising:
a nucleic acid-guided endonuclease, a sequence-specific targeting nucleic acid and an amphipathic helical peptide, wherein the nucleic acid-guided endonuclease, the sequence-specific targeting nucleic acid and the amphipathic helical peptide form a complex, and wherein the amphipathic helical peptide mediates delivery of the complex to a target cell, and wherein the nucleic acid-guided endonuclease mediates editing or deletion of a target gene in the target cell.
2 . The composition of claim 1 , wherein the amphipathic helical peptide is selected from the group consisting of:
(SEQ ID NO: 5)
H2N-LHHLLHHLLHHLHHLLHHLHHLLHHL-COOH;
(SEQ ID NO: 6)
H2N-LHKLLHHLLHHLHKLLHHLHHLLHKL-COOH;
(SEQ ID NO: 7)
H2N-LHKLLHHLLHKLHHLLHKLHHLLHHL-COOH;
(SEQ ID NO: 8)
H2N-LHHLLHHLLHHLHHL-COOH;
(SEQ ID NO: 9)
H2N-HHLLHHLHHLLHHL-COOH;
(SEQ ID NO: 10)
H2N-LHLLHHLLHHLHHL-COOH;
(SEQ ID NO: 11)
H2N-LHHLLHLLHHLLHHL-COOH;
(SEQ ID NO: 12)
H2N-LHKLLHHLLHHLHK-COOH;
(SEQ ID NO: 13)
H2N-LHKLLHHLHHLLHKL-COOH;
(SEQ ID NO: 14)
H2N-KLHHLLHKLHHLLHH-COOH;
(SEQ ID NO: 15)
H2N-HLHLLHHLLHH-COOH;
(SEQ ID NO: 16)
H2N-LHLLHHLLHH-COOH;
(SEQ ID NO: 17)
H2N-LHKLLHHLLHKLHHL-COOH;
(SEQ ID NO: 18)
H2N-LHLLHH-COOH;
(SEQ ID NO: 19)
H2N-LHHLL-COOH;
(SEQ ID NO: 20)
H2N-LHKLL-COOH
and
Endo-Porter;
wherein the amphipathic helical peptide is Endoporter; or,
wherein the nucleic acid-guided endonuclease is Cas9, optionally wherein the Cas9 is an E. coli Cas9, a Streptococcus pyogenes Cas9, or a Staphylococcus aureus Cas9.
3 - 5 . (canceled)
6 . The composition of claim 1 , wherein the sequence-specific targeting nucleic acid is a guide RNA, optionally wherein:
the guide RNA is between 15 and 30 bases in length, and comprises a region which is at least 90% homologous to GGTTTGGAGTCACGTCAGGG (SEQ ID NO: 1), GGATTTAAGGTGCTATGGCG (SEQ ID NO: 2), GGAGTCGAAGAACATCTGCA (SEQ ID NO: 3) or GGAGTACTGCAGGCATACGG (SEQ ID NO: 4), optionally wherein the guide RNA comprises a region that is at least 95% homologous to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 or the guide RNA comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.
7 - 9 . (canceled)
10 . The composition of claim 1 , wherein the target gene is RIP140.
11 . The composition of claim 1 , wherein the target cell is mammalian, optionally wherein the target cell is an adipocyte or a pre-adipocyte.
12 . (canceled)
13 . The composition of claim 1 , wherein the complex further comprises an aptamer molecule with binding specificity for the target cell, optionally wherein:
the aptamer forms a non-covalent binding interaction with the amphipathic helical peptide; or the aptamer is conjugated to the amphipathic helical peptide.
14 - 15 . (canceled)
16 . The composition of claim 1 , wherein the complex is encapsulated in a glucan particle (GP).
17 . A method of editing or deleting a target gene in a cell comprising contacting a cell with a complex comprising a nucleic acid-guided endonuclease, a sequence-specific targeting nucleic acid and an amphipathic helical peptide and allowing the complex to enter the cell and edit or delete the target gene.
18 . The method of claim 17 , wherein the amphipathic helical peptide is selected from the group consisting of:
(SEQ ID NO: 5)
H2N-LHHLLHHLLHHLHHLLHHLHHLLHHL-COOH;
(SEQ ID NO: 6)
H2N-LHKLLHHLLHHLHKLLHHLHHLLHKL-COOH;
(SEQ ID NO: 7)
H2N-LHKLLHHLLHKLHHLLHKLHHLLHHL-COOH;
(SEQ ID NO: 8)
H2N-LHHLLHHLLHHLHHL-COOH;
(SEQ ID NO: 9)
H2N-HHLLHHLHHLLHHL-COOH;
(SEQ ID NO: 10)
H2N-LHLLHHLLHHLHHL-COOH;
(SEQ ID NO: 11)
H2N-LHHLLHLLHHLLHHL-COOH;
(SEQ ID NO: 12)
H2N-LHKLLHHLLHHLHK-COOH;
(SEQ ID NO: 13)
H2N-LHKLLHHLHHLLHKL-COOH;
(SEQ ID NO: 14)
H2N-KLHHLLHKLHHLLHH-COOH;
(SEQ ID NO: 15)
H2N-HLHLLHHLLHH-COOH;
(SEQ ID NO: 16)
H2N-LHLLHHLLHH-COOH;
(SEQ ID NO: 17)
H2N-LHKLLHHLLHKLHHL-COOH;
(SEQ ID NO: 18)
H2N-LHLLHH-COOH;
(SEQ ID NO: 19)
H2N-LHHLL-COOH;
(SEQ ID NO: 20)
H2N-LHKLL-COOH
and
Endo-Porter;
or
wherein the amphipathic helical peptide is Endo-Porter.
19 . (canceled)
20 . The method of claim 17 , wherein said target gene is RIP140, optionally wherein:
said cell is an adipocyte or a pre-adipocyte; or said sequence-specific targeting nucleic acid is a guide RNA.
21 - 22 . (canceled)
23 . The method of claim 22 , wherein the guide RNA is between 15 and 30 bases in length, and comprises a region which is at least 90% homologous to GGTTTGGAGTCACGTCAGGG (SEQ ID NO: 1), GGATTTAAGGTGCTATGGCG (SEQ ID NO: 2), GGAGTCGAAGAACATCTGCA (SEQ ID NO: 3) or GGAGTACTGCAGGCATACGG (SEQ ID NO: 4), optionally wherein:
the guide RNA comprises a region that is at least 95% homologous to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; or the guide RNA comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.
24 - 25 . (canceled)
26 . The method of claim 18 , wherein:
said nucleic acid-guided endonuclease is Cas9; or the complex further comprises an aptamer molecule with binding specificity for the target cell, optionally wherein the aptamer forms a non-covalent binding interaction with the amphipathic helical peptide or is conjugated to the amphipathic helical peptide.
27 - 29 . (canceled)
30 . The method of claim 18 , wherein the complex is encapsulated in a glucan particle (GP).
31 . A method of improving glucose tolerance in a subject, comprising:
administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a complex including a nucleic acid-guided endonuclease, a sequence-specific targeting nucleic acid and an amphipathic helical peptide, wherein the complex edits or deletes a target gene in the subject; or contacting an adipocyte cell or pre-adipocyte cell ex vivo with a complex including a Cas9, a RIP140 guide RNA and an amphipathic helical peptide for a sufficient amount of time to delete or inactivate RIP140 gene in the cell, and implanting into the subject the cell having the deleted or inactivated RIP140 gene.
32 . The method of claim 31 , wherein the amphipathic helical peptide is selected from the group consisting of:
(SEQ ID NO: 5)
H2N-LHHLLHHLLHHLHHLLHHLHHLLHHL-COOH;
(SEQ ID NO: 6)
H2N-LHKLLHHLLHHLHKLLHHLHHLLHKL-COOH;
(SEQ ID NO: 7)
H2N-LHKLLHHLLHKLHHLLHKLHHLLHHL-COOH;
(SEQ ID NO: 8)
H2N-LHHLLHHLLHHLHHL-COOH;
(SEQ ID NO: 9)
H2N-HHLLHHLHHLLHHL-COOH;
(SEQ ID NO: 10)
H2N-LHLLHHLLHHLHHL-COOH;
(SEQ ID NO: 11)
H2N-LHHLLHLLHHLLHHL-COOH;
(SEQ ID NO: 12)
H2N-LHKLLHHLLHHLHK-COOH;
(SEQ ID NO: 13)
H2N-LHKLLHHLHHLLHKL-COOH;
(SEQ ID NO: 14)
H2N-KLHHLLHKLHHLLHH-COOH;
(SEQ ID NO: 15)
H2N-HLHLLHHLLHH-COOH;
(SEQ ID NO: 16)
H2N-LHLLHHLLHH-COOH;
(SEQ ID NO: 17)
H2N-LHKLLHHLLHKLHHL-COOH;
(SEQ ID NO: 18)
H2N-LHLLHH-COOH;
(SEQ ID NO: 19)
H2N-LHHLL-COOH;
(SEQ ID NO: 20)
H2N-LHKLL-COOH
and
Endo-Porter;
wherein the amphipathic helical peptide is Endo-Porter; or
wherein the sequence-specific targeting nucleic acid is a guide RNA.
33 - 34 . (canceled)
35 . The method of claim 31 , wherein the target gene is RIP140, optionally wherein the RIP140 gene is inactivated or deleted.
36 . (canceled)
37 . The method of claim 31 , wherein:
the method results in increased fatty acid oxidation in the subject; the nucleic acid-guided endonuclease is Cas9; the complex further comprises an aptamer molecule with binding specificity for the target cell; the aptamer forms a non-covalent binding interaction with the amphipathic helical peptide. the aptamer is conjugated to the amphipathic helical peptide; or the complex is encapsulated in a glucan particle (GP).
38 - 42 . (canceled)
43 . The method of claim 31 , wherein the subject is at risk for or suffering from a disorder related to glucose metabolism, optionally wherein the disorder is type 2 diabetes, prediabetes or gestational diabetes, optionally wherein the method results in one or more of a decrease in white fat levels, an increase in brown fat levels and an increase in beige fat levels.
44 - 52 . (canceled)
53 . A guide RNA of between 15 and 30 bases in length, that comprises a region which is at least 95% or 98% homologous to SEQ ID NO: 1, 2, 3, or 4.
54 - 68 . (canceled)Join the waitlist — get patent alerts
Track US2023183752A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.