Gamma herpesvirus circular rna

Abstract

In an embodiment, the invention provides a method and reagents for detection of γ-herpesvirus circRNA. In another embodiment, the invention provides a method and reagents for detection of EBV circRNA. In still another embodiment, the invention provides a method and reagents for detection of KSHV circRNA. The method can be expanded to other herpesviruses and even non-herpesviruses that generate circRNA upon cellular infection.

1 . An oligonucleotide that hybridizes, under high stringency conditions, to a sequence selected from the sequences set forth in the Examples set forth herein entitled “EXAMPLE 1—Epstein-Barr Virus (EBV) circRNA” and “EXAMPLE 2—Kaposi's Sarcoma-Associated Herpesvirus (KSHV) circRNA,” wherein said oligonucleotide comprises between 10 and 30 nucleic acids. 
     
     
         2 . An oligonucleotide that hybridizes to the BART small junction (SJ) sequence (TCGACGGGCAAGGTCCGGCGTGTC (SEQ ID NO:7)), the BART large junction (LJ) sequence (TCGACGGGCAAGATGCCATTGGGC (SEQ ID NO:8)), or the RF junction sequence (CATCTACCTCAGCCCCCGCGCCCC (SEQ ID NO:13). 
     
     
         3 . The oligonucleotide of  claim 2 , which comprises the following sequence: GGGGCGCGGGGGCTGAGGUAGAUG (SEQ ID NO:14), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 14 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 14 is connected by a phosphorothioate bond. 
     
     
         4 . The oligonucleotide of  claim 2 , which comprises the following sequence: GACACGCCGGACCTTGCCCGUCGA (SEQ ID NO:9), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 9 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 9 is connected by a phosphorothioate bond. 
     
     
         5 . The oligonucleotide of  claim 2 , which comprises the following sequence: GCCCAATGGCATCTTGCCCGUCGA (SEQ ID NO:11), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 11 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 11 is connected by a phosphorothioate bond. 
     
     
         6 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of  claim 1  to the mammal in an amount effective to treat or prevent the condition in the mammal. 
     
     
         7 . The method according to  claim 6 , wherein the γ-herpesvirus infection is a KSHV infection. 
     
     
         8 . The method according to  claim 6 , wherein the condition is Kaposi's Sarcoma or lymphoma. 
     
     
         9 . The method according to  claim 6 , wherein the γ-herpesvirus infection is an EBV infection. 
     
     
         10 . The method according to  claim 6 , wherein the condition is infectious mononucleosis, lymphoma, or nasopharyngeal cancer. 
     
     
         11 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of  claim 3  to the mammal in an amount effective to treat or prevent the condition in the mammal. 
     
     
         12 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of  claim 4  to the mammal in an amount effective to treat or prevent the condition in the mammal. 
     
     
         13 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of  claim 5  to the mammal in an amount effective to treat or prevent the condition in the mammal. 
     
     
         14 . The method according to  claim 11 , wherein the γ-herpesvirus infection is a KSHV infection. 
     
     
         15 . The method according to  claim 11 , wherein the condition is Kaposi's Sarcoma or lymphoma. 
     
     
         16 . A composition comprising the oligonucleotide of  claim 2  and a pharmaceutically-acceptable carrier. 
     
     
         17 . A composition comprising the oligonucleotide of  claim 3  and a pharmaceutically-acceptable carrier. 
     
     
         18 . A composition comprising the oligonucleotide of  claim 4  and a pharmaceutically-acceptable carrier. 
     
     
         19 . A composition comprising the oligonucleotide of  claim 1  and a pharmaceutically-acceptable carrier. 
     
     
         20 . A vector comprising a circRNA and a gene of interest expressed under the control of a heterologous promoter.