US2023272380A1PendingUtilityA1

Engineered Guide RNA Sequences for In Situ Detection and Sequencing

Assignee: HARVARD COLLEGEPriority: Nov 2, 2016Filed: May 8, 2023Published: Aug 31, 2023
Est. expiryNov 2, 2036(~10.2 yrs left)· nominal 20-yr term from priority
C12N 9/222C12N 2310/20C12N 15/11C12N 15/1096C12Q 1/6853C12N 15/10C12N 9/22C12N 15/113C12N 2310/3519C12N 2310/531
74
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A functional engineered guide RNA sequence is provided including a spacer sequence and a scaffold sequence, wherein the scaffold sequence includes a primer binding site for reverse transcription.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . A functional engineered guide RNA sequence including a spacer sequence and a scaffold sequence, wherein the scaffold sequence includes a nucleic acid sequence for reverse transcription. 
     
     
         2 . The functional engineered guide RNA sequence of  claim 1  wherein the scaffold sequence include a tracr mate sequence with the nucleic acid sequence for reverse transcription attached to the tracr mate sequence. 
     
     
         3 . The functional engineered guide RNA sequence of  claim 1  wherein the scaffold sequence include a tracr mate sequence with the nucleic acid sequence for reverse transcription attached to the 3′-end of the tracr mate sequence. 
     
     
         4 . The functional engineered guide RNA sequence of  claim 1  wherein the scaffold sequence includes a tracr mate sequence and a tracr sequence. 
     
     
         5 . The functional engineered guide RNA sequence of  claim 1  wherein the scaffold sequence includes a tracr mate sequence linked to a tracr sequence. 
     
     
         6 . The functional engineered guide RNA sequence of  claim 1  wherein the scaffold sequence includes a tracr mate sequence linked to a tracr sequence by a linker sequence and wherein the linker sequence comprises the nucleic acid sequence for reverse transcription. 
     
     
         7 . The functional engineered guide RNA sequence of  claim 1  wherein the nucleic acid sequence for reverse transcription is a reverse transcription primer binding site sequence or docking site sequence. 
     
     
         8 . The functional engineered guide RNA sequence of  claim 1 , wherein the nucleic acid sequence for reverse transcription is an added nucleic acid sequence for reverse transcription. 
     
     
         9 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein at least one loop structure of the one or more stem and loop structure comprises a nucleic acid sequence for reverse transcription. 
     
     
         10 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein at least one loop structure of the one or more stem and loop structure comprises a reverse transcription primer binding site sequence or docking site sequence. 
     
     
         11 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein at least one loop structure of the one or more stem and loop structure is modified to include a nucleic acid sequence for reverse transcription. 
     
     
         12 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein at least one loop structure of the one or more stem and loop structure is modified to include a reverse transcription primer binding site sequence or docking site sequence. 
     
     
         13 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein one or more loops of the one or more stem and loop structure is modified to include a nucleic acid sequence for reverse transcription. 
     
     
         14 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein one or more loops of the one or more stem and loop structure is modified to include a reverse transcription primer binding site sequence or docking site sequence. 
     
     
         15 . The functional engineered guide RNA sequence of  claim 1 , wherein the scaffold sequence includes one or more stem and loop structures, wherein at least one loop structure of the one or more stem and loop structure comprises a reverse transcription primer binding site sequence or docking site sequence, wherein the loop structure comprising the reverse transcription primer binding site sequence or docking site sequence is proximate the spacer sequence. 
     
     
         16 . The functional engineered guide RNA sequence of  claim 1  having the sequence [spacer]-[tracr mate]-[nucleic acid sequence including or being a nucleic acid sequence for reverse transcription]-[tracr]. 
     
     
         17 . The functional engineered guide RNA sequence of  claim 1  having the sequence [spacer]-[tracr mate]-[nucleic acid sequence including or being a reverse transcription primer binding site sequence or docking site sequence]-[tracr]. 
     
     
         18 . The functional guide RNA of  claim 1  having the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTA[nucleic acid sequence including or being a nucleic acid sequence for reverse transcription]TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGC-3′. 
 
     
     
         19 . The functional guide RNA of  claim 1  having the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTA[nucleic acid sequence including or being a reverse transcription primer binding site sequence or docking site sequence]TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGC-3′. 
 
     
     
         20 . The functional guide RNA of  claim 1  having the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAATTA   TAATTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGC-3′. 
 
     
     
         21 . The functional guide RNA of  claim 1  having the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTT[nucleic acid sequence including or being a nucleic acid sequence for reverse transcription]AAGTGGCACCGAGTCGGTGC-3′. 
 
     
     
         22 . The functional guide RNA of  claim 1  having the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTT[nucleic acid sequence including or being a reverse transcription primer binding site sequence or docking site sequence]AAGTGGCACCGAGTCGGTGC-3′. 
 
     
     
         23 . The functional guide RNA of  claim 1  having the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTTATTACA TAATAAGTGGCAC CGAGTCGGTGC-3′. 
 
     
     
         24 . A  Streptococcus pyogenes  single guide RNA having at least 40% homology with the sequence
 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTA[Linker]TAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTT[Linker]AAGTGGCACCGAGTCGGTGC-3′ wherein one or more of the linkers includes a reverse transcription primer binding site.   
     
     
         25 . The  Streptococcus pyogenes  single guide RNA of  claim 24  having the sequence 5′NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTA[Linker]TAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTT[Linker]AAGTGGCACCGAGTCGGTGC-3′. 
     
     
         26 . The  Streptococcus pyogenes  single guide RNA of  claim 24  where the reverse transcription primer binding site contains the sequence CACTGTTGTCTTATACCAAC. 
     
     
         27 . The  Streptococcus pyogenes  single guide RNA of  claim 24  where the reverse transcription primer binding site has or includes a sequence with at least 49% homology with sequence CACTGTTGTCTTATACCAAC. 
     
     
         28 . The  Streptococcus pyogenes  single guide RNA of  claim 24  where the reverse transcription primer binding site has or includes a sequence with at least 49% homology with sequence CACTGTTGTC. 
     
     
         29 . A method of identifying a spacer sequence of a functional guide RNA sequence within a cell including one or more RNA-guided DNA binding proteins comprising,
 providing the cell with the functional guide RNA sequence including a scaffold sequence, wherein the scaffold sequence includes a primer binding site for reverse transcription,   reverse transcribing the spacer sequence using the primer binding site to produce cDNA,   amplifying the cDNA to produce amplicons, and   sequencing the amplicons.   
     
     
         30 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes an RNA-guided DNA binding protein nuclease. 
     
     
         31 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a thermophilic RNA-guided DNA binding protein nuclease. 
     
     
         32 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes an RNA-guided DNA binding protein nickase. 
     
     
         33 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a nuclease null RNA-guided DNA binding protein. 
     
     
         34 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a Cas nuclease, a Cas nickase or a nuclease null Cas protein. 
     
     
         35 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a Cas9 nuclease, a Cas9 nickase or a nuclease null Cas9 protein. 
     
     
         36 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a spCas9 nuclease, a spCas9 nickase or a nuclease null spCas9 protein. 
     
     
         37 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes  S. pyogenes  Cas9,  S. thermophilis  Cas9,  N. meningitidis  Cas9,  T. denticola  Cas9, or  S. aureus  Cas9. 
     
     
         38 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a Cpf1 nuclease, a Cpf1 nickase or a nuclease null Cpf1 protein. 
     
     
         39 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a nuclease null Cas9 protein having a modulator attached thereto. 
     
     
         40 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a nuclease null Cas9 protein having a detectable moiety attached thereto. 
     
     
         41 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a nuclease null Cas9 protein having a protein domain attached thereto. 
     
     
         42 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a nuclease null Cas9 protein having a nuclease attached thereto. 
     
     
         43 . The method of  claim 29  wherein the one or more RNA-guided DNA binding proteins includes a phosphatase, deaminase, kinase, polynucleotide kinase, Uracil-DNA glycosylase, nuclease, endonuclease, exonuclease, site-specific nuclease, ligase, polymerase, recombinase, methyl-transferase, fluorescent protein, beta-galactosidase, antibody, scFv single-chain variable fragment of an antibody, nanobody, transcriptional activator, transcriptional repressor, biotin, streptavidin, aptamer, nanoparticle, gold nanoparticle, quantum dot, magnetic bead, paramagnetic particle, or oligonucleotide attached thereto. 
     
     
         44 . The method of  claim 29  wherein the engineered guide RNA is a homing guide RNA. 
     
     
         45 . A method of making a functional engineered guide RNA sequence which is reverse transcribable comprising providing a primer binding site for reverse transcription at a location within the functional guide RNA which maintains function of the functional guide RNA and also allows the functional guide RNA to be reverse transcribed.

Join the waitlist — get patent alerts

Track US2023272380A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.