US2023277590A1PendingUtilityA1

Compositions and methods for treating mesothelin positive cancers

Assignee: A2 BIOTHERAPEUTICS INCPriority: Aug 20, 2020Filed: Dec 7, 2022Published: Sep 7, 2023
Est. expiryAug 20, 2040(~14.1 yrs left)· nominal 20-yr term from priority
C12N 2310/14C12N 15/113A61K 40/4255C07K 16/2833C07K 16/30C07K 14/70503A61K 40/31A61K 40/11A61K 40/32C12N 15/1138C12N 5/0636A61P 35/00C07K 2317/622C12N 2501/2302C12N 2510/00C07K 14/705C07K 2319/03C12N 2501/2315C07K 14/70539C12N 2310/531C12N 2502/30A61K 38/00C07K 14/7051C12N 2501/2321A61K 35/17
68
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The disclosure provides immune cells comprising a first activator receptor specific to mesothelin and a second inhibitory receptor specific to a ligand that has been lost in a mesothelin-positive cancer cell, and methods of making and using same for the treatment of cancer.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . An immune cell comprising:
 a. a first receptor, comprising an extracellular ligand binding domain specific to Mesothelin (MSLN); and   b. a second receptor, comprising an extracellular ligand binding domain specific to a non-target antigen lost in a MSLN+ cancer cell,   wherein the first receptor is an activator receptor responsive to MSLN; and wherein the second receptor is an inhibitory receptor responsive to the non-target antigen.   
     
     
         2 . The immune cell of  claim 1 , wherein the non-target antigen is lost in the MSLN+ cancer cell through loss of heterozygosity. 
     
     
         3 . The immune cell of  claim 1  or  2 , wherein the extracellular ligand binding domain of the second receptor specifically binds an allelic variant of a major histocompatibility complex (MHC) protein. 
     
     
         4 . The immune cell of any one of  claims 1 - 3 , wherein the extracellular ligand binding domain of the second receptor specifically binds an allelic variant of an HLA-A, HLA-B, or HLA-C protein. 
     
     
         5 . The immune cell of any one of  claims 1 - 4 , wherein the extracellular ligand binding domain of the second receptor specifically binds to HLA-A*01, HLA-A*02, HLA-A*03, HLA-A*11, HLA-B*07, or HLA-C*07. 
     
     
         6 . The immune cell of  claim 5 , wherein the extracellular ligand binding domain of the second receptor specifically binds to HLA-A*02. 
     
     
         7 . The immune cell of any one of  claims 1 - 6 , wherein the extracellular ligand binding domain of the second receptor comprises complementarity determining regions (CDRs) CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, CDR-H3 as disclosed Table 6; or CDR sequences having at most 1, 2, or 3 substitutions, deletions, or insertion relative to the CDRs of Table 6 or Table 7. 
     
     
         8 . The immune cell of any one of  claims 1 - 6 , wherein the extracellular ligand binding domain of the second receptor comprises complementarity determining regions (CDRs) CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, CDR-H3 of SEQ ID NOS: 42-47 or of SEQ ID NOS: 48-53; or CDR sequences having at most 1, 2, or 3 substitutions, deletions, or insertion relative to the CDRs of SEQ ID NOS: 42-47 or SEQ ID NOS: 48-53. 
     
     
         9 . The immune cell of any one of  claims 1 - 6 , wherein the extracellular ligand binding domain of the second receptor comprises a polypeptide sequence selected from the polypeptide sequence disclosed in Table 5; or a sequence having at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         10 . The immune cell of any one of  claims 1 - 6 , wherein the extracellular ligand binding domain of the second receptor comprises any one of SEQ ID NOS: 30-41, or a sequence having at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         11 . The immune cell of any one of  claims 1 - 10 , wherein the first receptor is a chimeric antigen receptor (CAR). 
     
     
         12 . The immune cell of any one of  claims 1 - 11 , wherein the extracellular ligand binding domain of the first receptor comprises complementarity determining regions (CDRs) CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, CDR-H3 as disclosed Table 2; or CDR sequences having at most 1, 2, or 3 substitutions, deletions, or insertions relative to the CDRs of Table 2. 
     
     
         13 . The immune cell of any one of  claims 1 - 11 , wherein the extracellular ligand binding domain of the first receptor comprises a variable heavy (VH) portion comprising a sequence set forth in Table 3 and a variable light (VL) portion comprising a sequence set forth in Table 4; or a sequence having at least 80%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         14 . The immune cell of any one of  claims 1 - 13 , wherein the extracellular ligand binding domain of the first receptor comprises a variable heavy (VH) portion comprising SEQ ID NO: 233 or a sequence having at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity thereto, and a variable light (VL) portion comprising SEQ ID NO: 279 or a sequence having 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity thereto. 
     
     
         15 . The immune cell of any one of  claims 1 - 13 , wherein the extracellular ligand binding domain of the first receptor comprises a sequence selected from the group consisting of SEQ ID NOS: 3-6, 80 and 154-215, or a sequence having at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity thereto. 
     
     
         16 . The immune cell of any one of  claims 1 - 13 , wherein the extracellular ligand binding domain of the first receptor comprises an scFv sequence of SEQ ID NO: 171; or a sequence having at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         17 . The immune cell of any one of  claims 1 - 16 , wherein the first receptor comprises a hinge domain, a transmembrane domain and an intracellular domain. 
     
     
         18 . The immune cell of  claim 17 , wherein the hinge domain comprises a CD8α hinge domain. 
     
     
         19 . The immune cell of  claim 18 , wherein the CD8α hinge domain comprises a sequence of SEQ ID NO: 7, or a sequence having at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         20 . The immune cell of any one of  claims 11 - 19 , wherein the transmembrane domain comprises a CD28 transmembrane domain. 
     
     
         21 . The immune cell of  claim 20 , wherein the CD28 transmembrane domain comprises a sequence of SEQ ID NO: 11, or a sequence having at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         22 . The immune cell of any one of  claims 11 - 21 , wherein the intracellular domain comprises a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain, and a CD3ζ activation domain. 
     
     
         23 . The immune cell of  claim 22 , wherein the intracellular domain comprises a sequence of SEQ ID NO: 285, or a sequence having at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         24 . The immune cell of any one of  claims 1 - 23 , wherein the first receptor comprises a sequence of SEQ ID NO: 303, or a sequence having at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         25 . The immune cell of any one of  claims 1 - 24 , wherein the second receptor comprises a LILRB1 intracellular domain or a functional variant thereof. 
     
     
         26 . The immune cell of  claim 25 , wherein the LILRB1 intracellular domain comprises a sequence at least 90%, at least 95%, at least 97%, at least 99%, or is identical to SEQ ID NO: 70. 
     
     
         27 . The immune cell of any one of  claims 1 - 26 , wherein the second receptor comprises a LILRB1 transmembrane domain or a functional variant thereof. 
     
     
         28 . The immune cell of  claim 27 , wherein the LILRB1 transmembrane domain or a functional variant thereof comprises a sequence at least 90%, at least 95%, at least 97%, at least 99% or is identical to SEQ ID NO: 74. 
     
     
         29 . The immune cell of any one of  claims 1 - 28 , wherein the second receptor comprises a LILRB1 hinge domain or functional variant thereof. 
     
     
         30 . The immune cell of  claim 29 , wherein the LILRB1 hinge domain comprises a sequence at least 90%, at least 95%, at least 97%, at least 99% or is identical to SEQ ID NO: 73. 
     
     
         31 . The immune cell of any one of  claims 1 - 30 , wherein the second receptor comprises a LILRB1 intracellular domain, a LILRB1 transmembrane domain, a LILRB1 hinge domain, a functional variant of any of these, or combinations thereof. 
     
     
         32 . The immune cell of  claim 31 , wherein the LILRB1 hinge domain, LILRB1 intracellular domain and LILRB1 transmembrane domain comprises SEQ ID NO: 71 or a sequence at least 90%, at least 95%, at least 97%, at least 99% or is identical to SEQ ID NO: 71. 
     
     
         33 . The immune cell of any one of  claims 1 - 32 , wherein the second receptor comprises a sequence of SEQ ID NO: 348, or a sequence having at least 90%, at least 95%, at least 97%, or at least 99% identity thereto. 
     
     
         34 . The immune cell of any one of  claims 1 - 33 , wherein the MSLN+ cancer cell is a mesothelioma cancer cell, an ovarian cancer cell, a cervical cancer cell, a colorectal cancer cell, an esophageal cancer cell, a head and neck cancer cell, a kidney cancer cell, an uterine cancer cell, a gastric cancer cell, a pancreatic cancer cell, a lung cancer cell, a colorectal cancer cell or a cholangiocarcinoma cell. 
     
     
         35 . The immune cell of  claim 34 , wherein the MSLN+ cancer cell is a mesothelioma cancer cell, an ovarian cancer cell, a cervical cell, a uterine cancer cell, a gastric cancer cell, a pancreatic cancer cell or a lung adenocarcinoma cell. 
     
     
         36 . The immune cell of any one of  claims 1 - 35 , wherein the MSLN+ cancer cell is a MSLN+/HLA-A*02− cancer cell that does not express HLA-A*02. 
     
     
         37 . The immune cell of  claim 36 , wherein the MSLN+/HLA-A*02− cancer cell is derived from a MSLN+/HLA-A*02+ cell by loss of heterozygosity at HLA-A leading to loss of HLA-A*02. 
     
     
         38 . The immune cell of any one of  claims 1 - 37 , wherein the first receptor and the second receptor together specifically activate the immune cell in the presence of the MSLN+/HLA-A*02− cancer cell having loss of heterozygosity. 
     
     
         39 . The immune cell of any one of  claims 1 - 38 , wherein the first receptor and the second receptor together do not specifically activate the immune cell in the presence of an MSLN+ cell that has not lost HLA-A*02 by loss of heterozygosity. 
     
     
         40 . The immune cell of any one of  claims 1 - 39 , wherein the immune cell is a T cell. 
     
     
         41 . The immune cell of  claim 40 , wherein the T cell is a CD8+CD4− T cell. 
     
     
         42 . The immune cell of any one of  claims 1 - 41 , wherein expression and/or function of a MHC Class I gene has been reduced or eliminated. 
     
     
         43 . The immune cell of  claim 42 , wherein the MHC Class I gene is beta-2-microglobulin (B2M). 
     
     
         44 . The immune cell of  claim 43 , further comprising a polynucleotide comprising an interfering RNA, the interfering RNA comprising a sequence complementary to a sequence of a B2M mRNA. 
     
     
         45 . The immune cell of  claim 44 , wherein the interfering RNA comprises a sequence selected from the group of sequences set forth in Table 13, or a sequence having at most 1, 2, 3, or 4 substitutions, insertions or deletions relative thereto. 
     
     
         46 . The immune cell of  claim 44  or  45 , wherein the interfering RNA is capable of inducing RNAi-mediated degradation of the B2M mRNA. 
     
     
         47 . The immune cell of  claim 46 , wherein the interfering RNA is a short hairpin RNA (shRNA). 
     
     
         48 . The immune cell of  claim 47 , wherein the shRNA comprises:
 a. a first sequence, having from 5′ end to 3′ end a sequence complementary to a sequence of the B2M mRNA; and   b. a second sequence, having from 5′ end to 3′ end a sequence complementary to the first sequence,   wherein the first sequence and the second sequence form the shRNA.   
     
     
         49 . The immune cell of  claim 47  or  48 , wherein the shRNA is encoded by a sequence comprising a sequence of GCACTCAAAGCTTGTTAAGATCGAAATCTTAACAAGCTTTGAGTGC (SEQ ID NO: 349) or GTTAACTTCCAATTTACATACCGAAGTATGTAAATTGGAAGTTAAC (SEQ ID NO: 350), or a sequence having at least 80%, at least 90%, or at least 95% identity thereto. 
     
     
         50 . The immune cell of  claim 43 , comprising one or more modifications to a sequence encoding B2M, wherein the one or more modifications reduce the expression and/or eliminate the function of B2M. 
     
     
         51 . The immune cell of  claim 50 , wherein the one or more modifications comprise one or more inactivating mutations of the endogenous gene encoding B2M. 
     
     
         52 . The immune cell of  claim 51 , wherein the one or more inactivating mutations comprise a deletion, an insertion, a substitution, or a frameshift mutation. 
     
     
         53 . The immune cell of any one of  claim 51  or  52 , wherein the one or more inactivating mutations are introduced with a nucleic acid guided endonuclease in a complex with at least one guide nucleic acid (gNA) that specifically targets a sequence of the endogenous gene encoding B2M. 
     
     
         54 . The immune cell of  claim 53 , wherein the gNA comprises a sequence selected from the group of sequences set forth in Table 12, or a sequence having at most 1, 2, 3, or 4 substitutions, insertions or deletions relative thereto. 
     
     
         55 . The immune cell of  claim 42 , wherein the MHC Class I gene is HLA-A*02. 
     
     
         56 . The immune cell of  claim 55 , further comprising a polynucleotide comprising an interfering RNA, comprising a sequence complementary to a sequence of an HLA-A*02 mRNA. 
     
     
         57 . The immune cell of  claim 56 , wherein the interfering RNA is capable of inducing RNA interference (RNAi)-mediated degradation of the HLA-A*02 mRNA. 
     
     
         58 . The immune cell of  claim 57 , wherein the interfering RNA is a short hairpin RNA (shRNA) comprising:
 a. a first sequence, having from 5′ end to 3′ end a sequence complementary to a sequence of the HLA-A*02 mRNA; and   b. a second sequence, having from 5′ end to 3′ end a sequence complementary to the first sequence,   wherein the first sequence and the second sequence form the shRNA.   
     
     
         59 . The immune cell of  claim 55 , comprising one or more modifications to a sequence of an endogenous gene encoding HLA-A*02, wherein the one or modifications reduce the expression and/or eliminate the function of HLA-A*02. 
     
     
         60 . The immune cell of  claim 59 , wherein the one or more modifications comprise one or more inactivating mutations of the endogenous gene encoding HLA-A*02. 
     
     
         61 . The immune cell of  claim 59  or  60 , wherein the one or more inactivating mutations are introduced with a nucleic acid guided endonuclease in a complex with at least one guide nucleic acid (gNA) that specifically targets a sequence of the endogenous gene encoding HLA-A*02. 
     
     
         62 . The immune cell of any one of  claims 1 - 61 , wherein the first receptor comprises a sequence of SEQ ID NO: 164, and the second receptor comprises a sequence of SEQ ID NO: 52, or sequences having at least 90%, at least 95%, at least 97% or at least 99% identity thereto. 
     
     
         63 . The immune cell of  claim 62 , comprising an shRNA encoded by a sequence comprising GCACTCAAAGCTTGTTAAGATCGAAATCTTAACAAGCTTTGAGTGC (SEQ ID NO: 349) or GTTAACTTCCAATTTACATACCGAAGTATGTAAATTGGAAGTTAAC (SEQ ID NO: 350) or a sequence having at least 80%, at least 90%, or at least 95% identity thereto. 
     
     
         64 . The immune cell of  claim 62  or  63 , wherein the first receptor and second receptor are encoded by a single polynucleotide, and wherein the sequences encoding the first and second receptors are separated by a sequence encoding a self-cleaving polypeptide. 
     
     
         65 . The immune cell of  claim 63 , wherein the self-cleaving polypeptide comprises a T2A self-cleaving polypeptide comprising a sequence of GSGEGRGSLLTCGDVEENPGP (SEQ ID NO: 351). 
     
     
         66 . The immune cell of any one of  claims 1 - 65 , wherein the immune cell is autologous. 
     
     
         67 . The immune cell of any one of  claims 1 - 65 , wherein the immune cell is allogeneic. 
     
     
         68 . A pharmaceutical composition, comprising a therapeutically effective amount of the immune cells of any one of  claims 1 - 67 . 
     
     
         69 . The pharmaceutical composition of  claim 68 , further comprising a pharmaceutically acceptable carrier, diluent or excipient. 
     
     
         70 . The pharmaceutical composition of  claim 68  or  69 , for use as a medicament in the treatment of MSLN+ cancer. 
     
     
         71 . A polynucleotide or polynucleotide system, comprising one or more polynucleotides comprising polynucleotide sequences encoding:
 a. a first receptor, comprising an extracellular ligand binding domain specific to Mesothelin (MSLN); and   b. a second receptor, comprising an extracellular ligand binding domain specific to a non-target antigen that has been lost in a MSLN+ cancer cell,   wherein the first receptor is an activator receptor responsive to MSLN on the MSLN+ cancer cell; and wherein the second receptor is an inhibitory receptor responsive to the non-target antigen.   
     
     
         72 . A polynucleotide or polynucleotide system, comprising one or more polynucleotides comprising polynucleotide sequences encoding the first receptor and the second receptor for use in generating the immune cells of any one of  claims 1 - 67 . 
     
     
         73 . The polynucleotide or polynucleotide system of  claim 71  or  72 , comprising a sequence encoding an shRNA specific to B2M. 
     
     
         74 . The polynucleotide or polynucleotide system of  claim 73 , wherein the sequences encoding the first receptor, the second receptor and the shRNA specific to B2M are encoded by the same polynucleotide. 
     
     
         75 . The polynucleotide or polynucleotide system of  claim 73  or  74 , wherein
 a. the sequence encoding the shRNA specific to B2M comprises GCACTCAAAGCTTGTTAAGATCGAAATCTTAACAAGCTTTGAGTGC (SEQ ID NO: 349) or GTTAACTTCCAATTTACATACCGAAGTATGTAAATTGGAAGTTAAC (SEQ ID NO: 350) or a sequence having at least 80%, at least 90%, or at least 95% identity thereto; 
 b. the sequence encoding the first receptor comprises a sequence encoding a polypeptide comprising a of SEQ ID NO: 303, or a sequence having at least 80%, at least 90%, or at least 95% identity thereto; and 
 c. the sequence encoding the second receptor comprises a sequence encoding a polypeptide comprising a sequence of SEQ ID NO: 348, or a sequence having at least 80%, at least 90%, or at least 95% identity thereto. 
 
     
     
         76 . A vector, comprising the one or more polynucleotides of any one of  claims 71 - 75 . 
     
     
         77 . A method of killing a MSLN+ cancer cell having loss of heterozygosity at an MHC class I locus, comprising administering to the subject an effective amount of the immune cell of any one of  claims 1 - 65  or the pharmaceutical composition of any one of  claims 66 - 68 . 
     
     
         78 . A method of treating MSLN+ cancer in a subject having a MSLN+ tumor having loss of heterozygosity at an MHC class I locus, comprising administering to the subject an effective amount of the immune cell of any one of  claims 1 - 67  or the pharmaceutical composition of any one of  claims 68 - 70 . 
     
     
         79 . A method of treating a cancer in a subject comprising:
 a. determining HLA-A genotype or expression of normal cells and a plurality of cancer cells of the subject;   b. optionally, determining the expression of MSLN in a plurality of cancer cells of the subject; and   c. administering to the subject an effective amount of the immune cell of any one of  claims 1 - 65  or the pharmaceutical composition of any one of  claims 66 - 68  if the normal cells express HLA-A*02 and the plurality of cancer cells do not express HLA-A*02, and the plurality of cancer cells are MSLN-positive.   
     
     
         80 . The method of  claim 79 , wherein the subject is a heterozygous HLA-A*02 patient with a malignancy that expresses MSLN (MSLN+) and has lost HLA-A*02 expression. 
     
     
         81 . The method of  claim 79 , wherein the subject is a heterozygous HLA-A*02 patient with recurrent unresectable or metastatic solid tumors that express MSLN and have lost HLA-A*02 expression. 
     
     
         82 . The method of any one of  claims 79 - 81 , wherein the cancer comprises mesothelioma cancer, ovarian cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck cancer, kidney cancer, uterine cancer, gastric cancer, pancreatic cancer, lung cancer, colorectal cancer, or cholangiocarcinoma. 
     
     
         83 . The method of any one of  claim 82 , wherein the cancer has relapsed in a subject, the cancer is refractory to one or more prior administered anticancer therapies, and/or the cancer is metastatic. 
     
     
         84 . The method of any one of  claims 79 - 83 , wherein the cancer cells comprise MSLN+/HLA-A*02− cancer cells that do not express HLA-A*02. 
     
     
         85 . The method of  claim 84 , wherein the MSLN+/HLA-A*02− cancer cells are derived from a MLSN+/HLA-A*02+ cell by loss of heterozygosity at HLA-A leading to loss of HLA-A*02. 
     
     
         86 . The method of any one of  claims 79 - 85 , wherein the first receptor and the second receptor together specifically activate the immune cell in the presence of the MSLN+/HLA-A*02-cancer cells. 
     
     
         87 . The method of any one of  claims 79 - 86 , wherein the first receptor and the second receptor together do not specifically activate the immune cell in the presence of a MSLN+ cell that has not lost HLA-A*02. 
     
     
         88 . The method of any one of  claims 79 - 87 , wherein administration of the immune cell of any one of  claims 1 - 58  or the pharmaceutical composition of any one of  claims 59 - 61  reduces the size of a tumor in the subject. 
     
     
         89 . The method of  claim 88 , wherein the tumor is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%. 
     
     
         90 . The method of  claim 88 , wherein the tumor is eliminated. 
     
     
         91 . The method of  claim 88  or  claim 89 , wherein administration of the immune cell or the pharmaceutical composition arrests the growth of a tumor in the subject. 
     
     
         92 . The method of any one of  claims 79 - 91 , wherein administration of the immune cell or the pharmaceutical composition reduces the number of tumors in the subject. 
     
     
         93 . The method of any one of  claims 79 - 92 , wherein administration of the immune cell or the pharmaceutical composition results in selective killing of a cancer cell but not a normal cell in the subject. 
     
     
         94 . The method of  claim 93 , wherein at least about 60% of the cells killed are cancer cells, about 65% of the cells killed are cancer cells, about 70% of the cells killed are cancer cells, about 75% of the cells killed are cancer cells, about 80% of the cells killed are cancer cells, about 85% of the cells killed are cancer cells, about 90% of the cells killed are cancer cells, about 95% of the cells killed are cancer cells, or about 100% of the cells killed are cancer cells. 
     
     
         95 . The method of  claim 93 , wherein administration of the immune cell or pharmaceutical composition results in the killing of at least about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or all of the cancer cells of the subject. 
     
     
         96 . The method of any one of  claims 79 - 95 , wherein administration of the immune cell or the pharmaceutical composition results in fewer side effects for the subject than administration of an otherwise equivalent immune cell comprising the first activator receptor but no second inhibitory receptor. 
     
     
         97 . A method of making a plurality of immune cells, comprising:
 a. providing a plurality of immune cells, and   b. transforming the plurality of immune cells with the polynucleotide system of any one of  claim 71 - 75 , or the vector of  claim 76 .   
     
     
         98 . A kit comprising the immune cell of any one of  claims 1 - 67  or the pharmaceutical composition of any one of  claims 68 - 708 . 
     
     
         99 . The kit of  claim 98 , further comprising instructions for use.

Join the waitlist — get patent alerts

Track US2023277590A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.