Ligation free methods of nucleic acid library preparation

Abstract

Provided herein are compositions and methods for generating libraries for high throughput sequencing without using ligation, and methods of using same.

What is claimed is: 
     
         1 . A method of preparing a library of nucleic acids, comprising:
 a. providing a sample of nucleic acids comprising at least one sequence of interest;   b. contacting the sample of nucleic acids with a plurality of first polymerase chain reaction (PCR) primers, and a first polymerase under conditions that allow PCR to occur, thereby generating a plurality of first single-sided PCR products;   c. contacting the plurality of first single-sided PCR products with a terminal transferase and dNTPs under conditions sufficient to transfer dNTPs to the 3′ ends of the plurality of first single-sided PCR products, thereby generating a plurality of PCR products comprising 3′ tails; and   d. contacting the plurality of PCR products comprising 3′ tails with a plurality of second PCR primers, and the first polymerase under conditions that allow PCR to occur;
 thereby generating a library of nucleic acids with adapters at the 5′ and 3′ ends. 
   
     
     
         2 . The method of  claim 1 , comprising:
 e. contacting the library of nucleic acids from (d) with a plurality of first indexing primers, a plurality of second indexing primers and a second polymerase under conditions that allow PCR to occur.   
     
     
         3 . The method of  claim 1  or  2 , wherein the plurality of first PCR primers comprise (i) a sequence complementary to a sequence adjacent to or overlapping the at least one sequence of interest, and (ii) a first adapter sequence. 
     
     
         4 . The method of  claim 3 , wherein the first adapter sequence is 5′ of the sequence complementary to the sequence adjacent to or overlapping the at least one sequence of interest. 
     
     
         5 . The method of any one of  claims 1 - 4 , wherein the 3′ tail is a polyA tail, a polyG tail, a polyC tail or a polyT tail. 
     
     
         6 . The method of any one of  claims 3 - 5 , wherein the sequence complementary to a sequence adjacent to or overlapping the at least one sequence of interest is a random sequence. 
     
     
         7 . The method of  claim 6 , wherein the random sequence is a random 9mer. 
     
     
         8 . The method any one of  claims 1 - 7 , wherein the plurality of first PCR primers comprise at least one basepair comprising a phosphorothioate linkage. 
     
     
         9 . The method of  claim 8 , herein the plurality of first PCR primers comprise two 3′ and two 5′ basepairs comprising phosphorothioate linkages. 
     
     
         10 . The method of any one of  claims 1 - 9 , wherein steps (b) and (d) comprise isothermal amplification reactions. 
     
     
         11 . The method of  claim 10 , wherein the first polymerase is Phi29, Klenow exo- or Bsu DNA Polymerase, Large Fragment. 
     
     
         12 . The method of any one of  claims 1 - 11 , wherein the plurality of second PCR primers comprise (i) a sequence complementary to the 3′ tails from step (c), and (ii) a second adapter sequence. 
     
     
         13 . The method of  claim 5 , wherein the second adapter sequence is 5′ of the sequence complementary to the 3′ tail. 
     
     
         14 . The method of  claim 12  or  13 , wherein the 3′ tails comprise polyG tails, and wherein the sequence complementary to the 3′ tail comprises polyC. 
     
     
         15 . The method any one of  claims 1 - 14 , wherein the plurality of second PCR primers comprise at least one basepair comprising a phosphorothioate linkage. 
     
     
         16 . The method of  claim 15 , herein the plurality of second PCR primers comprise two 3′ and two 5′ basepairs comprising phosphorothioate linkages. 
     
     
         17 . The method of any one of  claims 1 - 16 , wherein step (b) and/or (d) is carried out in an emulsion. 
     
     
         18 . The method of any one of  claims 2 - 17 , wherein first indexing primers comprise a sequence complementary to the first adapter and a first unique molecular identifier sequence (UMI). 
     
     
         19 . The method of any one of  claims 2 - 18 , wherein the second indexing primers comprise a sequence complementary to the second adapter and a second UMI sequence. 
     
     
         20 . The method of any one of  claims 1 - 19 , comprising contacting the sample of nucleic acids with a first enzyme prior to step (b) under conditions that allow for blunting of overhangs in the sample of nucleic acids, thereby generating a blunt-ended sample of nucleic acids. 
     
     
         21 . The method of  claim 20 , wherein the first enzyme comprises T4 polymerase, Klenow fragment, or Mung Bean Nuclease. 
     
     
         22 . The method of  claim 21 , comprising purifying the blunt-ended sample of nucleic acids. 
     
     
         23 . The method of  claim 22 , wherein the purifying comprises removing unincorporated dNTPs. 
     
     
         24 . The method of  claim 23 , wherein removing unincorporated dNTPs comprises treating with recombinant shrimp alkaline phosphatase (rSAP), purification using a column or bead-based purification. 
     
     
         25 . The method of any one of  claims 20 - 24 , comprising contacting the blunt-ended sample of nucleic acids with a second enzyme under conditions that allow for the addition of dideoxynucleotides (ddNTPs) to the to the 3′ ends of the blunt ended nucleic acids in the sample, and wherein contacting the blunt-ended sample of nucleic acids with the second enzyme occurs prior to step (b). 
     
     
         26 . The method of  claim 25 , wherein the second enzyme has 3′ to 5 exonuclease activity and polymerase activity but does not have 5′ to 3′ exonuclease activity. 
     
     
         27 . The method of  claim 26 , wherein the second enzyme comprises a Klenow fragment. 
     
     
         28 . The method of  claim 27 , comprising purifying the blunt-ended sample of nucleic acids after contacting the blunt-ended sample of nucleic acids with the second enzyme. 
     
     
         29 . The method of any one of  claims 1 - 28 , comprising purifying the plurality of first single-sided PCR products following step (b). 
     
     
         30 . The method of any one of  claims 1 - 29 , comprising purifying the plurality of first single-sided PCR products following step (b) and prior to step (c). 
     
     
         31 . The method of any one of  claims 1 - 30 , comprising purifying the plurality of PCR products comprising 3′ tails after step (c) and prior to step (d). 
     
     
         32 . The method of any one of  claims 1 - 31 , comprising purifying the plurality of PCR products from (d). 
     
     
         33 . The method of any one of  claims 32 - 32 , wherein the purifying comprises removing unincorporated dNTPs or ddNTPs. 
     
     
         34 . The method of any one of  claims 32 - 33 , wherein removing unincorporated ddNTPs comprises treating with recombinant shrimp alkaline phosphatase (rSAP), purification using a column, or bead-based purification. 
     
     
         35 . The method of  claim 34 , wherein the bead-based purification comprises SPRI magnetic beads. 
     
     
         36 . The method of any one of  claims 1 - 35 , wherein the nucleic acids comprise ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), or a combination thereof. 
     
     
         37 . The methods of any one of  claims 18 - 35 , wherein the first unique molecular identifier sequence (UMI) comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides. 
     
     
         38 . The method of  claim 37 , wherein the first UMI is a random sequence. 
     
     
         39 . The method of any one of  claims 1 - 38 , wherein the first adapter comprises a sequence of a first sequencing adapter. 
     
     
         40 . The method of  claim 39 , wherein the first adapter comprises a sequence of ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:4). 
     
     
         41 . The method of any one of  claims 19 - 040 , wherein the second UMI comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides. 
     
     
         42 . The method of  claim 41 , wherein the second UMI is a random sequence. 
     
     
         43 . The method of any one of  claims 1 - 42 , wherein the second adapter comprises a sequence of a second sequencing adapter. 
     
     
         44 . The method of  claim 43 , wherein the second adapter comprises a sequence of GACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:3). 
     
     
         45 . The method of any one of  claims 1 - 484  wherein the sequence adjacent to or overlapping the sequence of interest is within 1-500, 1-300, 1-200, 1-100, 1-75, 1-50 or 1-25 nucleotides of the sequence of interest. 
     
     
         46 . The method of any one of  claims 1 - 45 , wherein the sequence adjacent to or overlapping the sequence of interest is within 1-25 nucleotides of the sequence of interest. 
     
     
         47 . The method of any one of  claims 1 - 56 , wherein the sequence of interest comprises a single nucleotide polymorphism (SNP), a miniSTR (mini short tandem repeat), a mitochondrial marker, a Y chromosome marker, a taxonomic marker, or a disease trait marker. 
     
     
         48 . The method of  claim 47 , wherein the disease trait marker comprises a marker for pathogenicity, virulence, resistance or strain identification. 
     
     
         49 . The method of any one of  claims 1 - 48 , wherein the sample is degraded. 
     
     
         50 . The method of any one of  claims 1 - 49 , wherein the sample is a forensics sample. 
     
     
         51 . The method of any one of  claims 1 - 50 , comprising sequencing the library of nucleic acids. 
     
     
         52 . The methods of any one of  claims 1 - 51 , wherein the at least one sequence of interest comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 500, 1000, 10,000, 50,000, 100,000 or 200,000 unique sequences of interest. 
     
     
         53 . The method of any one of  claims 1 - 52 , comprising sequencing the library of nucleic acids. 
     
     
         54 . The method of  claim 53 , wherein the sequencing is high-throughput sequencing. 
     
     
         55 . A method of preparing a library of nucleic acids, comprising:
 a. providing a sample of nucleic acids comprising at least one sequence of interest;   b. contacting the sample of nucleic acids with a terminal transferase and dNTPs under conditions sufficient to transfer dNTPs to the 3′ ends of the nucleic acids, thereby generating a sample of nucleic acids comprising 3′ tails;   c. contacting the sample of nucleic acids comprising 3′ tails with a plurality of first polymerase chain reaction (PCR) primers, and a first polymerase under conditions that allow PCR to occur, thereby generating a plurality of first single-sided PCR products; and   d. contacting the plurality of first single-sided PCR products with a plurality of second PCR primers, and the first polymerase under conditions that allow PCR to occur;
 thereby generating a library of nucleic acids with adapters at the 5′ and 3′ ends. 
   
     
     
         56 . The method of  claim 55 , comprising:
 e. contacting the library of nucleic acids from (d) with a plurality of first indexing primers, a plurality of second indexing primers and a second polymerase under conditions that allow PCR to occur.   
     
     
         57 . The method of  claim 55  or  56 , wherein the 3′ tail is a polyA tail, a polyG tail, a polyC tail or a polyT tail. 
     
     
         58 . The method of any one of  claims 55 - 57 , wherein the plurality of first PCR primers comprise (i) a sequence complementary to the 3′ tails from step (c), and (ii) a first adapter sequence. 
     
     
         59 . The method of  claim 58 , wherein the first adapter sequence is 5′ of the sequence complementary to the 3′ tail. 
     
     
         60 . The method of any one of  claims 55 - 59 , wherein the 3′ tails comprise polyG tails, and wherein the sequence complementary to the 3′ tail comprises polyC. 
     
     
         61 . The method any one of  claims 55 - 60 , wherein the plurality of first PCR primers comprise at least one basepair comprising a phosphorothioate linkage. 
     
     
         62 . The method of  claim 65 , herein the plurality of first PCR primers comprise two 3′ and two 5′ basepairs comprising phosphorothioate linkages. 
     
     
         63 . The method of any one of  claims 55 - 62 , wherein the plurality of second PCR primers comprise (i) a sequence complementary to a sequence adjacent to or overlapping the at least one sequence of interest, and (ii) a second adapter sequence. 
     
     
         64 . The method of  claim 63 , wherein the second adapter sequence is 5′ of the sequence complementary to the sequence adjacent to or overlapping the at least one sequence of interest. 
     
     
         65 . The method of  claim 63  or  64 , wherein the sequence complementary to a sequence adjacent to or overlapping the at least one sequence of interest is a random sequence. 
     
     
         66 . The method of  claim 65 , wherein the random sequence is a random 9mer. 
     
     
         67 . The method any one of  claims 55 - 56 , wherein the plurality of second PCR primers comprise at least one basepair comprising a phosphorothioate linkage. 
     
     
         68 . The method of  claim 67 , wherein the plurality of second PCR primers comprise two 3′ and two 5′ basepairs comprising phosphorothioate linkages. 
     
     
         69 . The method of any one of  claims 55 - 68 , wherein steps (c) and (d) comprise isothermal amplification reactions. 
     
     
         70 . The method of  claim 69 , wherein the first polymerase is Phi29, Klenow exo- or Bsu DNA Polymerase, Large Fragment. 
     
     
         71 . The method of any one of  claims 55 - 70 , comprising purifying the sample of nucleic acids comprising 3′ tails produced at step (b). 
     
     
         72 . The method of any one of  claims 55 - 71 , comprising purifying the plurality of first single-sided PCR products produced at step (c). 
     
     
         73 . The method of any one of  claims 55 - 72 , comprising purifying the library of nucleic acids with adapters at the 5′ and 3′ ends produced at step (d). 
     
     
         74 . The method of any one of  claims 73 - 73 , wherein purifying the plurality of first single-sided PCR products comprises treating with recombinant shrimp alkaline phosphatase (rSAP), purification using a column or bead-based purification. 
     
     
         75 . The method of  claim 74 , wherein the beads are SPRI magnetic beads. 
     
     
         76 . The method of any one of  claims 55 - 75 , wherein step (b) is carried out in an emulsion. 
     
     
         77 . The method of any one of  claims 55 - 76 , wherein step (c) is carried out in an emulsion. 
     
     
         78 . The method of any one of  claims 56 - 77 , wherein first indexing primers comprise a sequence complementary to the first adapter and a first unique molecular identifier sequence (UMI). 
     
     
         79 . The method of any one of  claims 56 - 78 , wherein the second indexing primers comprise a sequence complementary to the second adapter and a second UMI sequence. 
     
     
         80 . The method of any one of  claims 56 - 79 , wherein the nucleic acids comprise ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), or a combination thereof. 
     
     
         81 . The methods of any one of  claims 78 - 80 , wherein the first unique molecular identifier sequence (UMI) comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides. 
     
     
         82 . The method of  claim 81 , wherein the first UMI is a random sequence. 
     
     
         83 . The method of any one of  claims 55 - 82 , wherein the first adapter comprises a sequence of a first sequencing adapter. 
     
     
         84 . The method of any one of  claims 79 - 83 , wherein the second UMI comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides. 
     
     
         85 . The method of  claim 84 , wherein the second UMI is a random sequence. 
     
     
         86 . The method of any one of  claims 55 - 85 , wherein the second adapter comprises a sequence of a second sequencing adapter. 
     
     
         87 . The method of any one of  claims 55 - 86 , wherein the sequence adjacent to or overlapping the sequence of interest is within 1-500, 1-300, 1-200, 1-100, 1-75, 1-50 or 1-25 nucleotides of the sequence of interest. 
     
     
         88 . The method of any one of  claims 55 - 87 , wherein the sequence adjacent to or overlapping the sequence of interest is within 1-25 nucleotides of the sequence of interest. 
     
     
         89 . The method of any one of  claims 55 - 88 , wherein the sequence of interest comprises a single nucleotide polymorphism (SNP), a miniSTR (mini short tandem repeat), a mitochondrial marker, a Y chromosome marker, a taxonomic marker, or a disease trait marker. 
     
     
         90 . The method of  claim 89 , wherein the disease trait marker comprises a marker for pathogenicity, virulence, resistance or strain identification. 
     
     
         91 . The method of any one of  claims 55 - 90 , wherein the sample is degraded. 
     
     
         92 . The method of any one of  claims 55 - 91 , wherein the sample is a forensics sample. 
     
     
         93 . The method of any one of  claims 55 - 92 , comprising sequencing the library of nucleic acids. 
     
     
         94 . The methods of any one of  claims 55 - 93 , wherein the at least one sequence of interest comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 500, 1000, 10,000, 50,000, 100,000 or 200,000 unique sequences of interest. 
     
     
         95 . The method of any one of  claims 55 - 94 , comprising sequencing the library of nucleic acids. 
     
     
         96 . The method of  claim 95 , wherein the sequencing is high-throughput sequencing. 
     
     
         97 . The methods of any one of  claims 1 - 96 , comprising:
 a. providing a plurality of guide nucleic acid (gNA)-CRISPR/Cas system protein complexes, wherein the gNAs are configured to hybridize to at least one sequence targeted for depletion;   b. mixing the library of nucleic acids with the plurality of gNA-CRISPR/Cas system protein complexes,
 wherein at least a portion of the gNA-CRISPR/Cas system protein complexes hybridize to at least one sequence targeted for depletion; and 
   c. incubating the mixture to cleave the at least one sequence targeted for depletion.   
     
     
         98 . The method of  claim 97 , comprising PCR amplifying the library of nucleic acids following step (c). 
     
     
         99 . The method of  claim 97  or  98 , wherein the CRISPR/Cas system protein comprises Cpf1, Cas9, Cas3, Cas8a-c, Cas10, CasX, CasY, Cas13, Cas14, Cse1, Csy1, Csn2, Cas4, Csm2, Cm5 or a combination thereof. 
     
     
         100 . The method of any one of  claims 97 - 99 , wherein the CRISPR/Cas system protein comprises Cas9, Cpf1 or a combination thereof. 
     
     
         101 . The method of any one of  claims 97 - 99 , wherein CRISPR/Cas system protein is a Cas9 or Cpf1 nickase. 
     
     
         102 . The method of any one of  claims 97 - 102 , wherein CRISPR/Cas system protein is thermostable. 
     
     
         103 . The method of any one of  claims 97 - 102 , wherein the gNAs are deoxyribonucleic acid (gDNAs) or ribonucleic acids (gRNAs). 
     
     
         104 . The method of any one of  claims 97 - 103 , wherein the plurality of gNAs comprise at least 2, 10, 10 2 , 10 3 , 10 4 , 10 5  or 10 6  unique gNAs. 
     
     
         105 . The method of any one of  claims 97 - 104 , comprising sequencing the library of nucleic acids. 
     
     
         106 . The method of  claim 105 , wherein the sequencing is high-throughput sequencing. 
     
     
         107 . The method of any one of  claims 1 - 106 , wherein the sample comprises nucleic acids of interest and nucleic acids targeted for depletion, and at least a subset of the nucleic acids targeted for depletion comprise a plurality of recognition sites for a modification-sensitive restriction enzyme. 
     
     
         108 . The method of  claim 107 , comprising terminally dephosphorylating a plurality of the nucleic acids in the sample. 
     
     
         109 . The method of  claim 107  or  108 , comprising contacting the sample with the modification-sensitive restriction enzyme under conditions that allow for the cleavage of the modification-sensitive restriction sites in the nucleic acids in the sample, thereby generating nucleic acids with exposed terminal phosphates; and contacting the sample with an exonuclease under conditions that allow for the successive removal of nucleotides from a phosphorylated end of a nucleic acid; thereby generating a sample enriched for nucleic acids of interest. 
     
     
         110 . The method of  claim 109 , comprising contacting the sample of nucleic acids with a modification-sensitive restriction enzyme under conditions that allow for the cleavage of the modification-sensitive restriction sites in the nucleic acids in the sample; thereby generating a sample enriched for nucleic acids of interest that have adapters on their 5′ and 3′ ends. 
     
     
         111 . A method of preparing a library of nucleic acids, comprising
 a. providing a sample of nucleic acids comprising at least one sequence of interest;   b. contacting the sample of nucleic acids with a terminal transferase and NTPs under conditions sufficient to transfer NTPs to the 3′ end of the nucleic acids thereby generating a plurality of nucleic acids comprising 3′ tails;   c. contacting the plurality of nucleic acids comprising 3′ tails with a plurality of first adapters and a reverse transcriptase under conditions sufficient for first strand complementary DNA (cDNA) synthesis to occur, thereby generating a plurality of cDNAs,
 wherein the plurality of cDNAs comprise 3′ polyC sequences; and 
   d. contacting the plurality of cDNAs with a second adapter under conditions sufficient to allow generation of double stranded DNA from the plurality of cDNAs to generate a plurality of double stranded DNAs,
 thereby preparing a library of nucleic acids with adapters at the 5′ and 3′ ends. 
   
     
     
         112 . The method of  claim 111 , wherein the plurality of first adapters comprise a sequence complementary to the 3′ tails and a first UMI sequence. 
     
     
         113 . The method of  claim 111  or  112 , wherein the plurality of second adapters comprise a second UMI and a polyG sequence. 
     
     
         114 . The method of any one of  claims 111 - 113 , wherein the nucleic acids comprise ribonucleic acids (RNAs). 
     
     
         115 . The method of any one of  claims 111 - 114 , wherein the reverse transcriptase comprises Moloney Murine Leukemia Virus (MMLV) reverse transcriptase. 
     
     
         116 . The method of  claim 111 , wherein step (d) comprises adding a polymerase. 
     
     
         117 . The method of  claim 116 , wherein step (d) comprises PCR amplification of the plurality of double stranded DNAs. 
     
     
         118 . The methods of any one of  claims 112 - 117 , wherein the first unique molecular identifier sequence (UMI) comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides. 
     
     
         119 . The method of claim  1117 , wherein the first UMI is a random sequence. 
     
     
         120 . The method of any one of  claims 111 - 109 , wherein the first adapter comprises a sequence of a first sequencing adapter. 
     
     
         121 . The method of any one of  claims 112 - 120 , wherein the second UMI comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides. 
     
     
         122 . The method of  claim 121 , wherein the second UMI is a random sequence. 
     
     
         123 . The method of any one of  claims 111 - 122 , wherein the second adapter comprises a sequence of a second sequencing adapter. 
     
     
         124 . The method of any one of  claims 111 - 123 , wherein the sequence of interest comprises a single nucleotide polymorphism (SNP), a miniSTR (mini short tandem repeat), a mitochondrial marker, a Y chromosome marker, or a disease trait marker. 
     
     
         125 . The method of  claim 124 , wherein the disease trait marker comprises a marker for pathogenicity, virulence, resistance or strain identification. 
     
     
         126 . The method of any one of  claims 111 - 125 , wherein the sample is degraded. 
     
     
         127 . The method of any one of  claims 111 - 126 , wherein the sample is a forensics sample. 
     
     
         128 . The method of any one of  claims 111 - 127 , wherein the at least one sequence of interest comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 500, 1000, 10,000, 50,000, 100,000 or 200,000 unique sequences of interest. 
     
     
         129 . The method of any one of  claims 111 - 128 , wherein the sample of nucleic acids comprises ribonucleic acids (RNAs). 
     
     
         130 . The method of  claims 111 - 129 , comprising sequencing the library of nucleic acids. 
     
     
         131 . The method of  claim 130 , wherein the sequencing comprises high-throughput sequencing. 
     
     
         132 . The methods of any one of  claims 111 - 128 , comprising:
 a. providing a plurality of guide nucleic acid (gNA)-CRISPR/Cas system protein complexes, wherein the gNAs are configured to hybridize to at least one sequence targeted for depletion;   b. mixing the library of nucleic acids with the plurality of gNA-CRISPR/Cas system protein complexes,
 wherein at least a portion of the gNA-CRISPR/Cas system protein complexes hybridize to the at least one sequence targeted for depletion; and 
   c. incubating the mixture to cleave the at least one sequence targeted for depletion.   
     
     
         133 . The method of  claim 132 , comprising PCR amplifying the library of nucleic acids following step (c). 
     
     
         134 . The method of  claim 132  or  133 , wherein the CRISPR/Cas system protein comprises Cpf1, Cas9, Cas3, Cas8a-c, Cas10, CasX, CasY, Cas13, Cas14, Cse1, Csy1, Csn2, Cas4, Csm2, Cm5 or a combination thereof. 
     
     
         135 . The method of any one of  claims 132 - 134 , wherein the CRISPR/Cas system protein comprises Cas9, Cpf1 or a combination thereof. 
     
     
         136 . The method of any one of  claims 132 - 135 , wherein CRISPR/Cas system protein is a Cas9 or Cpf1 nickase. 
     
     
         137 . The method of any one of  claims 132 - 136 , wherein CRISPR/Cas system protein is thermostable. 
     
     
         138 . The method of any one of  claims 132 - 137 , wherein the gNAs are deoxyribonucleic acids (gDNAs) or ribonucleic acids (gRNAs). 
     
     
         139 . The method of any one of  claims 132 - 138 , wherein the plurality of gNAs comprise at least 2, 10, 10 2 , 10 3 , 10 4 , 10 5  or 10 6  unique gNAs. 
     
     
         140 . The method of any one of  claims 132 - 139 , comprising sequencing the library of nucleic acids. 
     
     
         141 . The method of  claim 140 , wherein the sequencing is high throughput sequencing.