US2024002841A1PendingUtilityA1

Means and methods for modifying multiple alleles

69
Assignee: OCTAPHARMA AGPriority: Jun 20, 2016Filed: Jun 5, 2023Published: Jan 4, 2024
Est. expiryJun 20, 2036(~9.9 yrs left)· nominal 20-yr term from priority
C12N 15/11C12Y 304/21021C12N 9/6437C12N 15/102C12P 21/005C12N 9/22C12N 2310/20C12N 15/1137C12N 2800/80
69
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention relates to a method of modifying at least one gene in a cell via CRISPR/Cas, wherein the at least one gene has at least three alleles. The present invention further relates to cells obtainable by the method of the invention. Additionally, the present invention provides a method of producing a protein in a cell obtainable by the method of modifying at least one gene of the invention. Moreover, the invention relates to proteins obtainable by the method of producing a protein and use thereof, for example in therapy.

Claims

exact text as granted — not AI-modified
1 . A method of modifying at least one gene in a cell via CRISPR/Cas, wherein the at least one gene has at least three alleles. 
     
     
         2 . The method of  claim 1 , wherein at least two genes are modified, wherein at least one of the two genes has at least three alleles. 
     
     
         3 . The method of  claim 1 , wherein at least two genes are modified, and wherein a first gene has at least three alleles and a second gene has at least three alleles, preferably four alleles. 
     
     
         4 . The method of  claim 1  wherein at least one, two, three, four or all alleles of the at least one gene, preferably of the at least two genes, are modified. 
     
     
         5 . The method of  claim 1 , wherein the at least one gene or the at least two genes is/are targeted in at least one, preferably in two, position(s) of the nucleotide sequence of its/their coding and/or regulatory region(s). 
     
     
         6 . The method of  claim 1 , wherein the cell is polyploid in at least one gene, preferably in at least one of the genes to be modified. 
     
     
         7 . The method of  claim 1 , wherein the cell is diploid, triploid or tetraploid in at least one of the genes. 
     
     
         8 . The method of  claim 1 , wherein the cell is triploid in a first gene and tetraploid in a second gene, preferably wherein the first gene and/or the second gene are to be modified. 
     
     
         9 . The method of  claim 1 , wherein modifying at least one gene via CRISPR/Cas results in introduction of one or more insertion(s), deletion(s) and/or substitution(s) of one or more nucleotides or a combination thereof in a coding and/or regulatory region of the at least one gene. 
     
     
         10 . The method of  claim 1 , wherein modifying at least one gene via CRISPR/Cas results in decreased transcription and/or expression of the least one gene and/or in production of a variant of the at least one gene which is truncated and/or has altered enzymatic activity. 
     
     
         11 . The method according to  claim 1 , wherein the cell is a human cell or is derived from a human cell. 
     
     
         12 . The method according to  claim 1 , wherein the cell is an immortalized cell. 
     
     
         13 . The method according to  claim 1 , wherein for each position to be targeted the CRISPR/Cas system comprises two gRNA plasmids, each gRNA plasmid comprising a specific targeting sequence. 
     
     
         14 . The method according to  claim 1 , wherein the at least one gene is B4GALNT3, B4GALNT4 or glutamine synthetase. 
     
     
         15 . The method according to  claim 2 , wherein the at least two genes are B4GALNT3 and B4GALNT4, preferably wherein the first gene is B4GALNT3 and the second gene is B4GALNT4. 
     
     
         16 . The method according to  claim 15 , wherein B4GALNT3 and B4GALNT4 are each targeted in two positions. 
     
     
         17 . The method according to  claim 14 , wherein the targeting sequences specific for B4GALNT3 are selected from ATTGCTGCAGATGACAACG (SEQ ID NO: 1)/TGGATTTTCCCTGGGCAGC (SEQ ID NO: 2) and CCCGGGACACCCTCTATCG (SEQ ID NO: 3)/GGCCGAAGCATGTCAGCGGG (SEQ ID NO: 4); and/or wherein the targeting sequences specific for B4GALNT4 are selected from GCGTGCACTTGTGTATTCG (SEQ ID NO: 5)/CCACAGTCACTCACCGCCT (SEQ ID NO: 6) and GGTTTCATCCACCCGGCGA (SEQ ID NO: 7)/GAGTCCATAGTTCTTCCACT (SEQ ID NO: 8). 
     
     
         18 . A cell obtainable by the method of  claim 1 . 
     
     
         19 . A method of producing a protein in a host cell, comprising the steps of:
 introducing at least one nucleic acid encoding said protein in a cell according to  claim 18 ;   culturing said host cell under conditions which permit the production of said protein; thereby producing the protein.   
     
     
         20 . The method of producing a protein according to  claim 19 , wherein the protein is a naturally occurring protein, an artificially created protein or a fragment thereof.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.