Oligonucleotides for tissue specific gene expression modulation

Abstract

This disclosure relates to a therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising: a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a off-target tissue.

1 - 16 . (canceled) 
     
     
         17 . A method treating, suppressing, or reducing severity of a neurodegenerative disease in a subject, the method comprising administering to the subject a therapeutically effective amount of a combination comprising:
 a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to a central nervous system, and   a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to an off-target tissue.   
     
     
         18 . A method of treating, suppressing, or reducing severity of a neurodegenerative disease in a subject, the method comprising administering to the subject a therapeutic combination of drugs, the combination of drugs comprising:
 a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to a central nervous system, and   a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a tissue outside the central nervous system, to block the action of the first conjugate outside the central nervous system.   
     
     
         19 . The method of treating of  claim 18 , wherein the first conjugate is administered to the subject prior to the second conjugate, concurrently with the second conjugate, or after the second conjugate. 
     
     
         20 . The method of  claim 18 , wherein the neurodegenerative disease is a disorder caused, in whole or in part, by abnormalities in cholesterol transport. 
     
     
         21 . The method of  claim 18 , wherein the neurodegenerative disease comprises one or more of amyotrophic lateral disease (ALS) and Alzheimer's disease (AD). 
     
     
         22 . The method of  claim 18 , wherein the RNA silencing agent inhibits expression of Apoliprotein E (ApoE) gene in the central nervous system and the second conjugate maintains cholesterol homeostasis. 
     
     
         23 . The method of  claim 18 , wherein the RNA silencing agent is an RNA molecule comprising 15 to 35 bases in length, comprising a region of complementarity which is substantially complementary to 5′ GUUUAAUAAAGAUUCACCAAGUUUCACGCAAA 3′ (SEQ ID NO: 1). 
     
     
         24 . The method of  claim 23 , wherein the RNA silencing agent comprises a region of complementarity which is substantially complementary to one or more of 5′ GAUUCACCAAGUUUA 3′ (SEQ ID NO: 2) and 5′ CAAGUUUCACGCAAA 3′ (SEQ ID NO: 3). 
     
     
         25 . The method of  claim 23 , wherein the RNA molecule comprises a single-stranded (ss) RNA or a double-stranded (ds) RNA. 
     
     
         26 . The method of  claim 18 , wherein the first conjugate comprises a Di-siRNA comprising a guide strand and a passenger strand. 
     
     
         27 . The method of  claim 26 , wherein the antagonist to the RNA silencing agent comprises a single-stranded oligonucleotide complementary to the guide strand. 
     
     
         28 . The method of  claim 18 , wherein the second targeting agent targets the second conjugate to a off-target tissue. 
     
     
         29 . The method of  claim 28 , wherein the second targeting agent comprises a GalNac. 
     
     
         30 . The method of  claim 18 , wherein the antagonist to the RNA silencing agent comprises one or more locked nucleic acids. 
     
     
         31 . The method of  claim 18 , wherein the antagonist to the RNA silencing agent comprises 8 to 20 bases in length. 
     
     
         32 . The method of  claim 18 , wherein the antagonist to the RNA silencing agent comprises 8 bases in length. 
     
     
         33 . The method of  claim 18 , wherein the antagonist to the RNA silencing agent comprises 15 bases in length. 
     
     
         34 . The method of  claim 18 , wherein the tissue outside the central nervous system comprises a clearance tissue. 
     
     
         35 . The method of  claim 18 , wherein the tissue outside the central nervous system comprises one or more of a liver tissue, a kidney tissue, and a spleen tissue. 
     
     
         36 . (canceled) 
     
     
         37 . A method of treating, suppressing, or reducing the severity of a neurodegenerative disease in a subject, the method comprising administering to the subject:
 a therapeutically effective amount of an RNA silencing agent inhibiting expression of a gene in a central nervous system; and   a conjugate comprising an antagonist of the RNA silencing agent and a targeting agent that targets the conjugate to a liver, to selectively inhibit the RNA silencing agent in the liver.   
     
     
         38 - 59 . (canceled) 
     
     
         60 . A method of reducing off-target tissue silencing from an RNA silencing agent in a subject, the method comprising administering to the subject a combination comprising:
 a first conjugate comprising the RNA silencing agent and a first targeting agent that targets the first conjugate to a target tissue, and   a second conjugate comprising an anti-RNA silencing agent and a second targeting agent that targets the second conjugate to an off-target tissue.   
     
     
         61 . The method of  claim 60 , wherein the first conjugate and the second conjugate are administered simultaneously. 
     
     
         62 . The method of  claim 60 , wherein the first conjugate and the second conjugate are administered sequentially.