Nucleotide sequence of two circular SSDNA associated with banana bunchy top virus and method for detection of banana bunchy top virus

Abstract

Nucleotide sequences of two circular single-stranded DNAs associated with Banana Bunchy Top Virus and the proteins encoded by the open reading frames in the nucleotide sequences are provided. A method for detecting Banana Bunchy Top Virus using the PCR technique based on the nucleotide sequences is also provided.

What is claimed is: 
     
       1. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide comprising amino acid sequence SEQ ID NO: 16, wherein said sequence is selected from the group consisting of: (a) nucleotide sequence SEQ ID NO: 3;   (b) fragments of nucleotide sequence SEQ ID NO: 3 that selectively hybridize to Banana Bunchy Top Virus (BBTV) DNA; and   (c) nucleotide sequences which, as a result of the aenetic code, are degenerate to the sequences of (a) or (b).   
     
     
       2. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide comprising amino acid sequence SEQ ID NO: 17, wherein said sequence is selected from the group consisting of: (a) nucleotide sequence SEQ ID NO: 4;   (b) fragments of nucleotide sequence SEQ ID NO. 4 that selectively hybridize to Banana Bunchy Top Virus (BBTV) DNA; and   (c) nucleotide sequences which, as a result of the aenetic code, are degenerate to the sequences of (a) or (b).   
     
     
       3. An isolated polypeptide, wherein said polypeptide is encoded by an open reading frame in a nucleotide sequence which is a subsequence of the Banana Bunchy Top Virus (BBTV) genome, said nucleotide sequence being nucleotide sequence SEQ ID NO: 3, or a nucleotide sequence which, as a result of the genetic code, is degenerate thereto. 
     
     
       4. An isolated polyoeptide, wherein said polypeptide is encoded by an open reading frame in a nucleotide sequence which is a subsequence of the Banana Bunchy Top Virus (BBTV) genome, said nucleotide sequence being nucleotide sequence SEQ ID NO: 4, or a nucleotide sequence which, as a result of the genetic code, is degenerate thereto. 
     
     
       5. The isolated protein of claim 4, wherein said protein is a replicase. 
     
     
       6. An isolated DNA molecule comprising a nucleotide sequence encoding a fragment of a component of the Banana Bunchy Top Virus (BBTV) genome, wherein said sequence is selected from the group consisting of: (a) nucleotide sequence SEQ ID NO. 1   (b) fragments of nucleotide sequence SEQ ID NO. 1 that selectively hybridize to Banana Bunchy Top Virus (BBTV) DNA; and   (c) nucleotide sequences which are degenerate to the sequences of (a) or (b).   
     
     
       7. A method for detecting Banana Bunchy Top Virus (BBTV) in plant tissues comprising the steps of: (a) extracting the total DNA of the plant tissues or the DNA of viruses contained in the plant tissues;   (b) selecting an inversely oriented primer pair from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4;   (c) performing polymerase chain reaction (PCR) using the extracted DNA as template and the selected primer pair to obtain a PCR product; and   (d) determining the size of the PCR product obtained, wherein a DNA fragment of 1.1 Kb is indicative of the presence of BBTV in the plant tissues.   
     
     
       8. The method of claim 7 wherein the plant is a banana plant. 
     
     
       9. The method of claim 8 wherein the banana plant is Musa sp. 
     
     
       10. The method of claim 8 wherein the selected primer pair is selected from the group consisting of: (a) CATGGTCTATCGAGGCAAGG (SEQ ID NO: 6) and GCAGATTCAATTGACGGAGG (SEQ ID NO: 7);   (b) CATGGTCTATCGAGGCAAGG (SEQ ID NO: 6) and CGAGATTCAAGACGGA (SEQ ID NO: 12); and   (c) ACCACCGGAGTACCCAGTTC (SEQ ID NO: 8) and TCCTGGTTCGAAGAAGCGCA (SEQ ID NO: 9).   
     
     
       11. The polypeptide of claim 3 wherein said polypeptide comprises amino acid sequence SEQ ID NO: 16. 
     
     
       12. The polypeptide of claim 4 wherein said polypeptide comprises amino acid sequence SEQ ID NO: 17.