Detection of C4A deletion by long range PCR

Abstract

Methods are described for detecting a deletion in the C4A gene (e.g., for detecting C4AQ0), by performing long range polymerase chain reaction amplification on a test sample comprising genomic DNA. The methods amplify target DNA comprising a retroviral insert in intron 9 of the C4A gene using primers designed such that PCR products are formed only if the test sample comprises genomic DNA comprising a deletion in the C4A gene; alternatively, the methods amplify target DNA comprising the junction between intron 9 and the retroviral insert in intron 9 of the C4A gene using primers designed such that PCR products are formed only if the test sample comprises genomic DNA that does not comprise the deletion in the C4A gene. Alternatively, primers are designed such that PCR products have detectably different sizes, depending on whether or the test sample comprises genomic DNA that comprises the deletion in the C4A gene. The methods can be used to identify whether an individual is at risk for systemic lupus erythematosus, as the presence of a deletion in the C4A gene correlates with risk for the disease, and can also be used for C4A deletion genotyping of an individual.

What is claimed is:  
     
       1. A method of detecting the presence or absence of a C4AQ0 deletion in the C4A gene, comprising: 
       a) subjecting a test sample comprising genomic DNA to long range polymerase chain reaction amplification of target DNA comprising a retroviral insert in intron 9 of the C4A gene, wherein the long range polymerase chain reaction amplification utilizes a forward primer that corresponds to a DNA sequence in the G11 gene, and a reverse primer that corresponds to a DNA sequence in exon 10 of the C4A gene, such that if the test sample comprises genomic DNA comprising a C4AQ0 deletion in the C4A gene, PCR products are formed, and if the test sample does not comprise genomic DNA comprising a C4AQ0 deletion in the C4A gene, no PCR products are formed; and  
       b) detecting the presence or absence of the PCR products, wherein the presence of PCR products is indicative of the presence of a C4AQ0 deletion in the C4A gene in the test sample, and the absence of PCR products is indicative of the absence of a C4AQ0 deletion in the C4A gene in the test sample.  
     
     
       2. The method of claim  1 , wherein PCR products, if present, are approximately 5.4 kb in size. 
     
     
       3. The method of claim  1 , wherein the forward primer is TCTAGCTTCAGTACTTCCAGCCTGT (SEQ ID NO:1); and the reverse primer is GATGACACAAAATACCAGGATGTGA (SEQ ID NO:2). 
     
     
       4. A method of detecting die presence or absence of a C4AQ0 deletion in the C4A gene, comprising: 
       a) subjecting a test sample comprising genomic DNA to long range polymerase chain reaction amplification of target DNA comprising a junction between intron 9 and retroviral insert in intron 9 of the C4A gene, wherein the long range polymerase chain reaction amplification utilizes a forward primer that corresponds to a DNA sequence in the G11 gene, and a reverse primer that corresponds to a DNA sequence in the junction between intron 9 and the retroviral insert in intron 9 of the C4A gene, such that if the test sample comprises genomic DNA comprising a C4AQ0 deletion in the C4A gene, no PCR products are formed, and if the test sample does not comprise genomic DNA comprising a C4AQ0 deletion in the C4A gene, PCR products are formed; and  
       b) detecting the presence or absence of the PCR products, wherein the presence of PCR products is indicative of the absence of a C4AQ0 deletion in the C4A gene in the test sample, and the absence of PCR products is indicative of the presence of a C4AQ0 deletion in the C4A gene in the test sample.  
     
     
       5. The method of claim  4 , wherein the PCR products, if present, are approximately 5.2 kb in size. 
     
     
       6. The method of claim  4 , wherein the forward primer is TCTAGCTTCAGTACTTCCAGCCTGT (SEQ ID NO:1); and the reverse primer is TGGTCCCAACATGTCTGTGCATGCTG (SEQ ID NO:3). 
     
     
       7. A method of determining whether an individual is at risk for developing systemic lupus erythematosus, comprising: 
       a) subjecting a test sample comprising genomic DNA from the individual to long range polymerase chain reaction amplification of target DNA comprising a retroviral insert in intron 9 of the C4A gene, wherein the long range polymerase chain reaction amplification utilizes a forward primer that corresponds to a DNA sequence in the G11 gene, and a reverse primer that corresponds to a DNA sequence in exon 10 of the C4A gene, such that if the test sample comprises genomic DNA comprising a C4AQ0 deletion in the C4A gene, PCR products are formed, and if the test sample does not comprise genomic DNA comprising a C4AQ0 deletion in the C4A gene, no PCR products are formed; and  
       b) detecting the presence or absence of the PCR products, wherein the presence of PCR products is indicative of the presence of a C4AQ0 deletion in the C4A gene in the test sample which correlates with a risk for developing systemic lupus erythematosus.  
     
     
       8. The method of claim  7 , wherein PCR products are, if present, are approximately 5.4 in size. 
     
     
       9. The method of claim  7 , wherein the forward primer is TCTAGCTTCAGTACTTCCAGCCTGT (SEQ ID NO:1); and the reverse primer is GATGACACAAAATACCAGGATGTGA (SEQ ID NO:2). 
     
     
       10. A method of determining whether an individual is at risk for developing systemic lupus erythematosus, comprising: 
       a) subjecting a test sample comprising genomic DNA from the individual to long range polymerase chain reaction amplification of target DNA comprising a junction between intron 9 and retroviral insert in intron 9 of the C4A gene, wherein the long range polymerase chain reaction amplification utilizes a forward primer that corresponds to a DNA sequence in the G11 gene, and a reverse primer that corresponds to a DNA sequence in the junction between intron 9 and the retroviral insert in intron 9 of the C4A gene, such that if the test sample comprises genomic DNA comprising a C4AQ0 deletion in the C4A gene, no PCR products are formed, and if the test sample does not comprise genomic DNA comprising a C4AQ0 deletion in the C4A gene, PCR products are formed; and  
       b) detecting the presence or absence of the PCR products, wherein the absence of PCR products is indicative of the presence or a C4AQ0 deletion in the C4A gene in the test sample which correlates with a risk for developing systemic lupus erythematosus.  
     
     
       11. The method of claim  10 , wherein the PCR products, if present, are approximately 5.2 kb in size. 
     
     
       12. The method of claim  10 , wherein the forward primer is TCTAGCTTCAGTACTTCCAGCCTGT (SEQ ID NO:1); and the reverse primer is TGGTCCCCAACATGTCTGTGCATGCTG (SEQ ID NO:3). 
     
     
       13. A method of determining C4A deletion genotype of an individual, comprising: 
       a) subjecting a test sample comprising genomic DNA from the individual to long range polymerase chain reaction amplification of target DNA comprising a retroviral insert in intron 9 of the C4A gene, wherein the long range polymerase chain reaction amplification utilizes a forward primer that corresponds to a DNA sequence in the G11 gene, and a reverse primer that corresponds to a DNA sequence in exon 10 of the C4A gene, such that if the test sample comprises genomic DNA comprising C4AQ0, PCR products are formed, and if the test sample does not comprise genomic DNA comprising a C4AQ0, no PCR products are formed; and  
       b) detecting the presence or absence of the PCR products, wherein the presence of PCR products indicates that the individual is either homozygous or heterozygous for C4AQ0, and the absence of PCR products indicates that the individual is homozygous for the absence C4AQ0.  
     
     
       14. The method of claim  12 , further comprising: 
       a) subjecting a test sample comprising genomic DNA from the individual to long range polymerase chain reaction amplification of target DNA comprising a junction between intron 9 and retroviral insert in intron 9 of the C4A gene, wherein the long range polymerase chain reaction amplification utilizes a forward primer that corresponds to a DNA sequence in the G11 gene, and a reverse primer that corresponds to a DNA sequence in the junction between intron 9 and the retroviral insert in intron 9 of the C4A gene, such that if the test sample comprises genomic DNA comprising a C4AQ0, no PCR products are formed, and if the test sample does not comprise genomic DNA comprising C4AQ0, PCR products are formed; and  
       b) detecting the presence or absence of the PCR products, wherein the absence of PCR products indicates that the individual is homozygous for C4AQ0, and the presence of PCR products indicates that the individual is heterozygous for C4AQ0.