US7029891B2ExpiredUtilityA1
α1,3-fucosyltransferase
Est. expiryJun 6, 2017(expired)· nominal 20-yr term from priority
C12Q 1/6886C12N 9/1051C07K 2319/00
78
PatentIndex Score
4
Cited by
34
References
21
Claims
Abstract
A bacterial α1,3-fucosyltransferase gene and deduced amino acid sequence is provided. The gene is useful for preparing α1,3-fucosyltransferase polypeptide, and active fragment thereof, which can be used in the production of oligosaccharides such as Lewis X, Lewis Y, and siayl Lewis X, which are structurally similar to certain tumor-associated carbohydrate antigens found in mammals. These product glycoconjugates also have research and diagnostic utility in the development of assays to detect mammalian tumors. In addition the polypeptide of the invention can be used to develop diagnostic and research assays to determine the presence of H. pylori in human specimens.
Claims
exact text as granted — not AI-modified1. An isolated Heliobacter polynucleotide that hybridizes under stringent conditions comprising 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. to a nucleic acid consisting of SEQ ID NO:4 or its complement and wherein the polynucleotide encodes a transmembrane segment-free polypeptide having α1,3-fucosyltransferase activity, or enzymatically active portions thereof.
2. An isolated polynucleotide encoding any one of the polypeptides as set forth in SEQ ID NOS:1–3 and 7, wherein said polynucleotide comprises a fragment of at least 15 nucleotides in length which will hybridize to SEQ ID NO:4 or its complement under stringent conditions comprising 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C.
3. A vector containing the polynucleotide of claim 1 .
4. A host cell containing the vector of claim 4 .
5. A recombinant method for producing a transmembrane segment-free α1,3-fucosyltransferase polypeptide, comprising:
a) growing a recombinant host cell containing a polynucleotide of claim 1 encoding a polypeptide having α1,3-fucosyltransferase activity under conditions which allow expression and secretion of the α1,3-fucosyltransferase polypeptide; and
b) isolating the α1,3-fucosyltransferase polypeptide.
6. A gene expression system for producing a transmembrane segment-free α1,3-fucosyltransferase comprising a host cell transformed with a polynucleotide of claim 1 encoding a polypeptide having α1,3-fucosyltransferase activity or an enzymatically active portion thereof.
7. The gene expression system of claim 6 , wherein the polynucleotide is DNA, cDNA, or RNA.
8. The gene expression system of claim 6 , wherein the host cell is selected from the group consisting of a bacterial cell, a yeast cell, a fungal cell, a plant cell, an insect cell, and an animal cell.
9. The gene expression system of claim 6 , wherein the host cell is. recombinantly modified by transfection with a plasmid.
10. The gene expression system of claim 9 , wherein the plasmid comprises a selectable marker.
11. The gene expression system of claim 10 , wherein the selectable marker is glutamine synthetase.
12. A method for producing a transmembrane segment-free α1,3-fucosyltransferase polypeptide, comprising the steps of:
a) culturing a gene expression system comprising a host cell transformed with a polynucleotide of claim 1 encoding a polypeptide having α1,3-fucosyltransferase activity or an enzymatically active portion thereof; and
b) harvesting the α1,3-fucosyltransferase.
13. The method of claim 12 , further comprising substantially purifying the harvested α1,3-fucosyltransferase polypeptide.
14. The method of claim 12 , wherein the host cell is recombinantly modified by transfection with a plasmid.
15. The method of claim 12 , wherein the host cell is selected from the group consisting of a bacterial cell, a yeast cell, a fungal cell, a plant cell, an insect cell, and an animal cell.
16. An isolated polynucleotide encoding a fusion construct wherein the isolated polynucleotide comprises:
(i) a first Helicobacter polynucleotide that hybridizes under stringent conditions comprising 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. to a nucleic acid consisting of SEQ ID NO:4 or its complement and wherein the polynucleotide encodes a transmembrane segment-free polypeptide having α1,3 fucosyltransferase activity, or enzymatically active portions thereof; and
(ii) a second polynucleotide that encodes a selectable marker, wherein the first and second polynucleotides are operably linked.
17. A host cell containing the polynucleotide of claim 16 .
18. A recombinant method for producing a transmembrane segment-free α1,3-fucosyltransferase fusion construct, comprising:
inserting the polynucleotide of claim 1 adjacent to a selectable marker, such tat the resulting polynucleotide encodes a recombinant α1,3-fucosyltransferase polypeptide fused to the selectable marker to form a fusion gene; and
expressing the fusion gene to produce the transmembrane segment-free α1,3 fucosyltransferase fusion construct.
19. A method of producing a transmembrane segment-free α1,3 fucosyltransferase-fusion protein comprising:
a) growing a host cell containing a polynucleotide of claim 1 encoding a polypeptide having α1,3-fucosyltransferase activity operably linked to a polynucleotide encoding a polypeptide or peptide of interest under conditions which allow expression and secretion of the fusion protein; and
b) isolating the fusion protein.
20. An isolated polynucleotide encoding a Helicobacter α1,3 fucosyltransferase polypeptide, wherein said polynucleotide is identical to a polynucleotide that is amplified using Helicobacter genomic DNA as a template by PCR using a first primer comprising GGATCCTCTGGCTTGCACAGCTAT (SEQ ID NO:28) and a second primer comprising GAATTCTTATAAGAATGTCTCTCAA (SEQ ID NO:30).
21. An isolated polynucleotide encoding a fusion construct wherein the isolated polynucleotide comprises:
(i) a first Helicobacter polynucleotide that is identical to a polynucleotide that is amplified using Helicobacter genomic DNA as template by PCR using a first primer comprising GGATCCTCTGGCTTGCACAGCTAT (SEQ ID NO:28) and a second primer comprising GAATTCTTATAAGAATGTCTCTCAA (SEQ ID NO:30) and wherein the polynucleotide encodes a polypeptide having α1,3 fucosyltransferase activity; and
(ii) a second polynucleotide that encodes a selectable marker, wherein the first and second polynucleotides are operably linked.Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.