US8057806B2ExpiredUtilityA1
Viruses comprising mutant ion channel protein
Est. expiryApr 14, 2020(expired)· nominal 20-yr term from priority
Inventors:Yoshihiro Kawaoka
C07K 14/005C12N 2760/16134C12N 7/00C12N 2760/16122A61K 2039/5256C12N 2760/16161A61P 31/16A61K 2039/53C07K 2319/00
96
PatentIndex Score
30
Cited by
175
References
13
Claims
Abstract
A method to prepare viruses lacking ion channel activity is provided.
Claims
exact text as granted — not AI-modified1. A method of preparing an attenuated recombinant influenza virus comprising a mutant M2 protein gene, comprising:
(i) transfecting an isolated a host cell with a plurality of influenza virus vRNA and influenza virus protein encoding vectors so as to yield recombinant influenza virus, wherein the plurality of vectors comprises: a) influenza virus vRNA vectors comprising a vector comprising a promoter operably linked to an influenza virus PA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA cDNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS cDNA linked to a transcription termination sequence, wherein the M cDNA comprises a mutation in the transmembrane domain of M2 protein DNA, wherein the mutation is a deletion of residues that include residues between residues 29 to 31, and wherein the mutation is associated with attenuation of the virus in vivo; and b) influenza virus protein encoding vectors comprising a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding an influenza A virus ion channel protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS2; and
(ii) isolating the virus.
2. The method of claim 1 wherein the host cell is further transfected with a vector encoding a heterologous immunogenic protein of a pathogen.
3. A method of preparing a recombinant influenza virus comprising a mutant M2 protein gene for a M2 protein which lacks or has reduced activity relative to the corresponding wild-type M2 protein, comprising:
(i) transfecting an isolated host cell with a plurality of influenza vectors so as to yield recombinant influenza virus, wherein the plurality of vectors comprises: a) a vector comprising a promoter operably linked to an influenza virus PA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA cDNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS cDNA linked to a transcription termination sequence, wherein the M cDNA comprises a mutation in the transmembrane domain of M2 protein DNA, wherein the mutation is the deletion of residues 29 to 31 of the transmembrane domain of M2 or is a deletion of one or more of residues 29 to 31 in the transmembrane domain of M2, and wherein the mutation does not substantially alter the in vitro replication of the virus in the absence of amantadine but is associated with attenuation of the virus in vivo; and b) a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector
comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding an ion channel protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS2; and
(ii) isolating the virus.
4. The method of claim 1 wherein the mutation is the deletion of at least residues 29 to 31.
5. A method of preparing an attenuated recombinant influenza virus comprising a mutant M2 protein gene for a mutant M2 protein which lacks or has reduced activity relative to the corresponding wild-type M2 protein, comprising:
(i) transfecting an isolated host cell with a plurality of influenza vectors so as to yield recombinant influenza virus, wherein the plurality of vectors comprises: a) a vector comprising a promoter operably linked to an influenza virus PA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA cDNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS cDNA linked to a transcription termination sequence, wherein the M cDNA comprises in the transmembrane domain of the M2 protein an alanine at residue 41 or a threonine at residue 27, and wherein the alanine or threonine do not substantially alter the in vitro replication of the virus in the absence of amantadine but is associated with attenuation of the virus in vivo; and b) a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding an ion channel protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS2; and
(ii) isolating the virus.
6. The method of claim 1 wherein the sequence which includes the mutation comprises to GTTGTTATCATTGGGATCTTGC (SEQ ID NO:5).
7. A method of preparing an attenuated recombinant influenza virus comprising a mutant M2 protein gene, comprising:
(i) transfecting an isolated host cell with a plurality of influenza vectors so as to yield recombinant influenza virus, wherein the plurality of vectors comprises: a) a vector comprising a promoter operably linked to an influenza virus PA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA cDNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA cDNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M cDNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS cDNA linked to a transcription termination sequence, wherein the M cDNA comprises in the transmembrane domain of the M2 protein: a threonine at residue 27, an alanine at residue 41, a deletion of residues that include residues 29 to 31 or a deletion of one or more of residues 29 to 31, and wherein the threonine, alanine or deletion is associated with attenuation of the virus in vivo; and b) a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding an ion channel protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS2; and
(ii) isolating the virus.
8. The method of claim 7 wherein the deletion is of residues 29 to 31 of the transmembrane domain of M2.
9. The method of claim 7 wherein the deletion is of at least residues 29 to 31.
10. The method of claim 7 wherein the amino acid at residue 41 of the M2 protein is an alanine.
11. The method of claim 7 wherein the amino acid at residue 27 of the M2 protein is a threonine.
12. The method of claim 7 wherein the deletion is of one or more of residues 29 to 31 in the transmembrane domain of M2.
13. The method of claim 7 wherein the sequence which includes the deletion comprises GTTGTTATCATTGGGATCTTGC (SEQ ID NO:5).Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.