P
US9359643B2ActiveUtilityPatentIndex 57

Discrimination of blood type variants

Assignee: PROGENIKA BIOPHARMA SAPriority: Mar 8, 2013Filed: Mar 8, 2013Granted: Jun 7, 2016
Est. expiryMar 8, 2033(~6.7 yrs left)· nominal 20-yr term from priority
Inventors:OCHOA JORGELOPEZ MONICAMOLANO ARAITZTEJEDOR DIEGOMARTINEZ ANTONIO
C12Q 2600/16C12Q 1/6881C12Q 2600/156
57
PatentIndex Score
2
Cited by
15
References
27
Claims

Abstract

The present invention provides a method for detecting the presence or absence of, or for discriminating between, blood type variants, including RHD*r′s, RHD*DIIIa and RHD*DIVa-2. The method comprises amplifying by PCR a sample obtained from a human subject at intron 3 of the RHD gene locus. The invention also provides products, in particular, probes, primers and kits for use in the method of the invention.

Claims

exact text as granted — not AI-modified
The invention claimed is: 
     
       1. An oligonucleotide polymerase chain reaction (PCR) primer, the nucleotide sequence of which is of the formula:
   X 1 —Y—Z
 
 
       wherein:
 X 1  is the final n nucleotides of the nucleotide sequence ATATGGAAATTTGATCATGT (SEQ ID NO: 1), wherein n is a number between 1 and 20, inclusive; 
 
       Y is Y 1  or Y 2 , wherein:
 Y 1  is the nucleotide sequence AS 1 TAATS 2 ATAC (SEQ ID NO: 2), wherein S 1  and S 2  are independently selected from G and C; and 
 Y 2  is a variant of Y 1  differing from Y 1 by no more than one nucleotide substitution, provided that said nucleotide substitution is not a substitution of the first A or final C of Y 1 ; 
 
       Z is the first m nucleotides in the nucleotide sequence TAAAG, wherein m is a number between 0 and 5, inclusive, 
       and wherein at least one nucleotide of said primer comprises a biotinylated nucleotide, a fluorescently labeled nucleotide, or a locked nucleic acid (LNA) base. 
     
     
       2. The primer according to  claim 1 , wherein X 1  is the nucleotide sequence of AAATTTGATCATGT (SEQ ID NO: 3) or ATGT. 
     
     
       3. The primer according to  claim 1 , wherein Y 1  is selected from the group consisting of: ACTAATCATAC (SEQ ID NO: 4); ACTAATGATAC (SEQ ID NO: 5); and AGTAATCATAC (SEQ ID NO: 6). 
     
     
       4. The primer according to  claim 1 , wherein m is 0. 
     
     
       5. The primer according to  claim 1 , wherein the primer is between 15 and 25 nucleotides in length. 
     
     
       6. The primer according to  claim 1 , wherein the nucleotide sequence of said primer consists of a nucleotide sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 7) 
                 
                 
                 
                 
               
                     
                   (i) 
                   AAATTTGATCATGTACTAATCATAC; 
                 
                     
                     
                 
                 
                 
               
                     
                   (SEQ ID NO: 8) 
                 
                 
                 
                 
               
                     
                   (ii) 
                   ATGTACTAATCATAC; 
                 
                     
                     
                 
                 
                 
               
                     
                   (SEQ ID NO: 9) 
                 
                 
                 
                 
               
                     
                   (iii) 
                   AAATTTGATCATGTACTAATGATAC; 
                 
                     
                   and 
                     
                 
                     
                     
                 
                 
                 
               
                     
                   (SEQ ID NO: 10) 
                 
                 
                 
                 
               
                     
                   (iv) 
                   AAATTTGATCATGTAGTAATCATAC. 
                 
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
                
               
            
             
                
               
            
             
                
               
            
           
         
       
     
     
       7. The primer according to  claim 1 , wherein said primer is suitable for use as a forward PCR primer in a PCR amplification of a portion of the r' S  allele of intron 3 of the RHD gene. 
     
     
       8. A plurality of oligonucleotide primers comprising:
 (i) an oligonucleotide primer as defined in  claim 1 ; and 
 (ii) at least one primer selected from the group consisting of:
 (a) an oligonucleotide primer of between 26 and 30 nucleotides in length comprising the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11) or a variant thereof differing by not more than 3 nucleotide substitutions from the nucleotide sequence of SEQ ID NO: 11, provided that said substitutions do not include substitution of the final T of the nucleotide sequence of SEQ ID NO: 11; 
 (b) an oligonucleotide primer consisting of the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11); 
 (c) the RHCE c forward primer consisting of the nucleotide sequence TGGGCTTCCTCACCTCAAA (SEQ ID NO: 12); 
 (d) the RHCE c reverse primer consisting of the nucleotide sequence TGATGACCACCTTCCCAGG (SEQ ID NO: 13); 
 (e) the RHCE C forward primer consisting of the nucleotide sequence GGCCACCACCATTTGAA (SEQ ID NO: 14); 
 (f) the RHCE C reverse primer consisting of the nucleotide sequence GGTAGCAGGCGTCTGTAAAAA (SEQ ID NO: 15); 
 (g) the RHCE exon 1 forward primer consisting of the nucleotide sequence CATAGACAGGCCAGCACAG (SEQ ID NO: 16); 
 (h) the RHCE exon 1 reverse primer consisting of the nucleotide sequence TGCCCCTGGAGAACCAT (SEQ ID NO: 17); 
 (i) the RHCE exon 5 forward primer consisting of the nucleotide sequence AAATTAAAATAAGCATTTGACCATC (SEQ ID NO: 18); 
 (j) the RHCE exon 5 reverse primer consisting of the nucleotide sequence CCTGAGATGGCTGTCACCAC (SEQ ID NO: 19); 
 (k) the RHCE exon 7 forward primer consisting of the nucleotide sequence ACATGCCATTGCCGTTC (SEQ ID NO: 20); and 
 (l) the RHCE exon 7 reverse primer consisting of the nucleotide sequence TCTCACCTGCCAATCTGCT (SEQ ID NO: 21). 
 
 
     
     
       9. The plurality of oligonucleotide primers according to  claim 8 , wherein said primers comprise at least (i) and (ii)(a). 
     
     
       10. The plurality of oligonucleotide primers according to  claim 9 , wherein said primers comprise the primer pair: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 7) 
                 
                     
                   AAATTTGATCATGTACTAATCATAC; 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 11) 
                 
                     
                   GGAAAAGGTTTGAGAGGAATTATATT. 
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
       11. A kit for assessing a subject's blood type, said kit comprising:
 a plurality of primers as defined in  claim 8 ; 
 optionally, one or more probes and/or primers that span one or more polymorphic positions in intron 3, exon 3, exon 4, intron 7 and/or exon 7 of the RHD gene locus; and 
 optionally, one or more probes and/or primers that span one or more polymorphic positions in exon 7 of the RHCE gene locus. 
 
     
     
       12. A system for use in determining a subject's blood type, the system comprising:
 a kit as defined in  claim 11 ; and 
 at least one detector arranged to detect a signal from detectably labelled DNA obtained from said subject or a detectably labelled amplicon produced by PCR amplification carried out on DNA obtained from said subject; 
 at least one controller in communication with the at least one detector, the controller being programmed with computer-readable instructions to transform said signal into predicted blood type haplotypes, and optionally, to transform said predicted blood type haplotypes into a predicted blood type phenotype. 
 
     
     
       13. A method for determining the presence or absence of, or for discriminating between, blood type alleles in a DNA-containing sample, which method comprises amplification by polymerase chain reaction (PCR) of at least a portion of intron 3 of the RHD gene, wherein said PCR employs at least a forward primer and a reverse primer each capable of hybridising to the portion of r' S  intron 3 sequence set forth in SEQ ID NO: 31, or its complement, and wherein said forward primer is as defined in  claim 1 . 
     
     
       14. The method according to  claim 13 , wherein said blood type alleles are alleles that comprise an RHD/RHCE hybrid exon 3. 
     
     
       15. The method according to  claim 13 , wherein said blood type alleles are selected from the group consisting of: RHD*r′ S ; RHD*r′ S -like; RHD*r′ S  Type 1; RHD*r′ S  Type 2; RHD*DIIIa; RHD*DIIIa IVS3+3100G; RHD*DIII_FN; RHD*DIVa-2; RHD*DIVa; RHD*DIII-type4; RHD*DIII-type6; RHD*DIII-type7; RHD*DIII-type8; RHCE*ce S ; RHCE*ce S 1006T ; RHCE*ce S 1006C; RHCE*ce733G; RHCE*ce48C,733G,1025T; RHCE*ce48C,697G,733G; RHCE*ce340T,733G; and RHCE*ce48C,733G,748A. 
     
     
       16. The method according to  claim 13 , wherein said PCR amplifies r′ S , but does not amplify one or more of: RHD; RHCE*ce; RHD*DIIIa; RHD*DIIIa IVS3+3100G; and RHD*DIVa. 
     
     
       17. The method according to  claim 16 , wherein said PCR amplifies r′ S , but does not amplify any of RHD; RHCE*ce; RHD*DIIIa; RHD*DIIIa IVS3+3100G; and RHD*DIVa. 
     
     
       18. The method according to  claim 13 , wherein the nucleotide sequence of said forward primer consists of the nucleotide sequence AAATTTGATCATGTACTAATCATAC (SEQ ID NO: 7). 
     
     
       19. The method according to  claim 13 , wherein said reverse primer is of between 26 and 30 nucleotides in length and comprises the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11). 
     
     
       20. The method according to  claim 13 , wherein the method further comprises genotyping the sample at one or more positions of single nucleotide polymorphism (SNP) in the RHD and/or RHCE gene loci. 
     
     
       21. The method according to  claim 20 , wherein the method comprises genotyping the sample at one or more of :
 (i) position 410 of the RHD exon 3; 
 (ii) position 602 of the RHD exon 4; 
 (iii) position 1048 of the RHD exon 7; 
 (iv) position 1006 of the RHCE exon 7; and 
 (v) position 3100 of the RHD intron 3. 
 
     
     
       22. A method of blood matching, the method comprising:
 carrying out the method according to  claim 13  on a recipient sample from a recipient subject in need of donor blood and on a donor sample from a potential donor subject; 
 comparing the blood type alleles present in the recipient sample with those present in the donor subject and thereby determining the compatibility of the recipient subject to receive blood from the potential donor subject. 
 
     
     
       23. An oligonucleotide polymerase chain reaction (PCR) primer, the nucleotide sequence of which consists of: 
       
         
           
                 
                 
                 
               
                     
                   AAATTTGATCATGTACTAATGATAC; 
                   (SEQ ID NO: 9) 
                 
                     
                   or 
                     
                 
                     
                     
                 
                     
                   AAATTTGATCATGTAGTAATCATAC. 
                   (SEQ ID NO: 10) 
                 
             
                
                
                
                
               
            
           
         
       
     
     
       24. A plurality of oligonucleotide primers comprising:
 (i) an oligonucleotide primer as defined in  claim 23 ; and 
 (ii) at least one primer selected from the group consisting of:
 (a) an oligonucleotide primer of between 26 and 30 nucleotides in length comprising the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11) or a variant thereof differing by not more than 3 nucleotide substitutions from the nucleotide sequence of SEQ ID NO: 11, provided that said substitutions do not include substitution of the final T of the nucleotide sequence of SEQ ID NO: 11; 
 (b) an oligonucleotide primer consisting of the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11); 
 (c) the RHCE c forward primer consisting of the nucleotide sequence TGGGCTTCCTCACCTCAAA (SEQ ID NO: 12); 
 (d) the RHCE c reverse primer consisting of the nucleotide sequence TGATGACCACCTTCCCAGG (SEQ ID NO: 13); 
 (e) the RHCE C forward primer consisting of the nucleotide sequence GGCCACCACCATTTGAA (SEQ ID NO: 14); 
 (f) the RHCE C reverse primer consisting of the nucleotide sequence GGTAGCAGGCGTCTGTAAAAA (SEQ ID NO: 15); 
 (g) the RHCE exon 1 forward primer consisting of the nucleotide sequence CATAGACAGGCCAGCACAG (SEQ ID NO: 16); 
 (h) the RHCE exon 1 reverse primer consisting of the nucleotide sequence TGCCCCTGGAGAACCAT (SEQ ID NO: 17); 
 (i) the RHCE exon 5 forward primer consisting of the nucleotide sequence AAATTAAAATAAGCATTTGACCATC (SEQ ID NO: 18); 
 (j) the RHCE exon 5 reverse primer consisting of the nucleotide sequence CCTGAGATGGCTGTCACCAC (SEQ ID NO: 19); 
 (k) the RHCE exon 7 forward primer consisting of the nucleotide sequence ACATGCCATTGCCGTTC (SEQ ID NO: 20); and 
 (l) the RHCE exon 7 reverse primer consisting of the nucleotide sequence TCTCACCTGCCAATCTGCT (SEQ ID NO: 21). 
 
 
     
     
       25. A method for determining the presence or absence of, or for discriminating between, blood type alleles in a DNA-containing sample, which method comprises amplification by polymerase chain reaction (PCR) of at least a portion of intron 3 of the RHD gene, wherein said PCR employs at least a forward primer and a reverse primer each capable of hybridising to the portion of r′ S  intron 3 sequence set forth in SEQ ID NO: 31, or its complement, and wherein said forward primer is as defined in  claim 23 . 
     
     
       26. An oligonucleotide polymerase chain reaction (PCR) primer, the nucleotide sequence of which is of the formula:
   X—Y—Z
 
 
       wherein: 
       X is X 1  or X 2 , wherein:
 X 1  is the final n nucleotides of the nucleotide sequence ATATGGAAATTTGATCATGT (SEQ ID NO: 1), wherein n is a number between 4 and 20, inclusive; and 
 X 2  is a variant of X 1  differing by not more than one nucleotide substitution; 
 
       Y is Y 1  or Y 2 , wherein:
 Y 1  is the nucleotide sequence AS 1 TAATS 2 ATAC (SEQ ID NO: 2), wherein S 1  and S 2  are independently selected from G and C; and 
 Y 2  is a variant of Y 1  differing from Y 1  by no more than one nucleotide substitution, provided that said nucleotide substitution is not a substitution of the first A or final C of Y 1 ; 
 
       Z is the first m nucleotides in the nucleotide sequence TAAAG, wherein m is a number between 0 and 5, inclusive, 
       and wherein at least one nucleotide of said primer comprises a biotinylated nucleotide, a fluorescently labeled nucleotide, or a locked nucleic acid (LNA) base. 
     
     
       27. The primer according to  claim 26 , wherein n is a number between 5 and 20, inclusive.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.