US9783593B2ActiveUtilityA1
Antibodies, variable domains and chains tailored for human use
Est. expiryMay 2, 2033(~6.7 yrs left)· nominal 20-yr term from priority
C12N 15/63C07K 16/00A01K 2207/15C07H 21/04C07K 16/462A01K 2217/075C07K 16/46C12N 15/8509A01K 67/0278A01K 2227/105A01K 2217/072C40B 50/06C40B 40/10
94
PatentIndex Score
19
Cited by
836
References
18
Claims
Abstract
The invention relates to the provision of antibody therapeutics and prophylactics that are tailored specifically for human use. The present invention provides libraries, vertebrates and cells, such as transgenic mice or rats or transgenic mouse or rat cells. Furthermore, the invention relates to methods of using the vertebrates to isolate antibodies or nucleotide sequences encoding antibodies. Antibodies, heavy chains, polypeptides, nucleotide sequences, pharmaceutical compositions and uses are also provided by the invention.
Claims
exact text as granted — not AI-modifiedThe invention claimed is:
1. A mouse whose genome comprises a homozygous immunoglobulin (Ig) heavy (H) chain locus comprising human Ig gene segment JH6*02, one or more human VH gene segments and a plurality of human D gene segments upstream of a constant (C) region comprising an endogenous CH gene segment of an IgH locus of said mouse; wherein said plurality of human D gene segments comprises at least one human D gene segment selected from the group consisting of D3-9 and D3-10, wherein the human gene segments in said H chain locus are operably linked to said constant region,
wherein said mouse has been contacted with a target antigen and produces a plurality of antibodies, each antibody comprising an H chain expressed from said IgH locus,
wherein in said plurality of antibodies the J region of the majority of antibodies of said mouse having a heavy chain having a CDR3 length of at least 20 amino acids is encoded by JH6*02, and wherein said target antigen is selected from the group consisting of an infectious disease pathogen, a receptor and an enzyme.
2. The mouse of claim 1 , wherein said IgH locus comprises a human JH6-02 recombination signal sequence (RSS) operably positioned 5′ to said JH6*02 gene segment.
3. The mouse of claim 2 , wherein the RSS is SEQ ID NO: 238 or a sequence having an identical 9mer and 7mer sequence flanking a sequence that is at least 70% identical to the 22mer sequence of SEQ ID NO: 238.
4. The mouse of claim 3 , wherein the RSS and said JH6*02 are provided as SEQ ID NO: 237.
5. The mouse of claim 1 , wherein said JH6*02 is the only JH6-type gene segment in said genome.
6. The mouse of claim 1 , wherein said JH6*02 is positioned in said IgH locus so as to be the JH gene segment most proximal to the constant region of said locus.
7. The mouse of claim 1 , wherein said locus further comprises one, more than one, or all human D gene segments selected from the group consisting of D4-17; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; D1-26; D1-20; D5-18; D3-16; D2-21; D1-14; D7-27; D1-1; D6-25; and D4-23.
8. The mouse of claim 7 , wherein said locus comprises one, more or all human D gene segments D6-19, D4-17, D6-13, D3-22, D2-2, D2-25 and D3-3.
9. The mouse of claim 1 , wherein the JH6*02 comprises a human germline configuration with respect to the 3′-most human D gene segment.
10. The mouse of claim 1 , wherein the locus comprises one, more than one or all of human IGH V gene segments selected from the group consisting of V3-21, V3-13, V3-7, V6-1, V1-8, V1-2, V7-4-1, V1-3, V1-18, V4-4, V3-9, V3-23, V3-11 and V3-20.
11. The mouse of claim 1 , wherein said locus comprises one, more than one or all human gene segments selected from the group consisting of D3-9-01, D3-10-01, D6-19-01, D6-13-01, D1-26-01, IGHV1-8-01, IGHV4-61-01, IGHV6-1-01, IGHV4-4-02, IGHV1-3-01, IGHV3-66-03, IGHV3-7-01 and IGHV3-9-01.
12. The mouse of claim 1 , wherein the human Ig gene segment JH6*02 comprises the sequence
(SEQ ID NO: 99)
ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGT
CACCGTCT CCTCAG.
13. The mouse of claim 1 , wherein JH6*02 is encoded by the majority of transcripts encoding long CDRH-3s from the spleen of said mouse, said majority comprising 66% of said transcripts.
14. The mouse of claim 1 , wherein JH6*02 is encoded by the majority of transcripts encoding long CDRH-3s from hybridomas generated using the spleen of said mouse, said majority comprising 63% of said transcripts.
15. The mouse of claim 1 , wherein said plurality of human D gene segments further comprises a human D gene segment selected from the group consisting of D6-19, D4-17, D6-13, D3-22 and D1-26.
16. The mouse of claim 1 , wherein said mouse produces an antibody specific for said target antigen, wherein the variable domain of the heavy chain of said antibody is the product of recombination between a human VH, D and JH6*02 and wherein the HCDR3 length is at least 20 amino acids.
17. The mouse of claim 16 , wherein said target antigen is a receptor, and wherein said antibody specifically binds a cleft of said receptor.
18. The mouse of claim 16 , wherein the target antigen is an enzyme and the antibody specifically binds an active site of said enzyme.Join the waitlist — get patent alerts
Track US9783593B2 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.