USRE37768EExpiredUtility
DNA encoding the 15 kD outer membrane protein of Haemophilus influenzae
Priority: Sep 7, 1993Filed: Apr 2, 1998Granted: Jun 25, 2002
Est. expirySep 7, 2013(expired)· nominal 20-yr term from priority
A61K 39/00C07K 14/285
29
PatentIndex Score
0
Cited by
5
References
26
Claims
Abstract
Murine monoclonal antibodies directed against a novel outer membrane protein (OMP) of Haemophilus influenzae have been isolated and characterized. The gene encoding of the outer membrane protein has also been isolated and characterized. Portions of the DNA sequence of the 15 kD OMP gene are useful as probes to diagnose the presence of Haemophilus influenzae in samples. These DNA's also make available polypeptide sequences of immunoreactive epitopes encoded within the gene, thus permitting the production of polypeptides which are useful as standards or reagents in diagnostic tests and/or as components of vaccines. Monoclonal antibodies directed against epitopes of the 15 kD OMP are also useful for diagnostic tests and as therapeutic agents for passive immunization.
Claims
exact text as granted — not AI-modifiedWe claim:
1. The recombinant polynucleotide having the sequence
10 20 30
GATCCCACCTTCTTTATTCCAATAATGGAA
40 50 60
CTTTATTTTATTAAAGGTATCTAAGTAGCA
,1 70 80 90
CCCTATATAGGGATTAATTAACGAGGTFFA
100 110 120
ATAATGAACTTTAACTAAAATTTTACCAGC
,1 130 140 l50
ATTTGCTGCTGTAGTCTGTATTATCTGCTT
160 170 180
GTGCAAAGGATGCACCTGAaATGACAAAAT
,1 190 200 210
CATCTGCGCAAATAGCTGAAATGCAAACAC
erSerAlaGlnIleAlaGluMetGlnThrL
220 230 240
TTCCAACAATCACTGATAAAACAGTTGTAT
euProThrIleThrAspLysThrValValT
,1 250 260 270
ATTCCTGCAATAAACAAACGGTGACTGCTG
yrSerCysAsnLysGlnThrValThrAlaV
280 290 300
TGTATCAATTTGAAAACCAAGAACCAGTTG
alTyrGlnPheGluAsnGlnGluPrnValA
,1 310 32O 330
CTGCAATGGTAAGTGTGGGCGATGGCATTA
laAlaMetValSerValGlyAspGlyIleI
340 350 360
TTGCCAAAGATTTTACTCGTGATAAATCAC
leAlaLysAspPheThrArgAspLysSerG
,1 370 380 390
AAAATGACTTTACAAGTTTCGTTTCTGGGG
InAsnAspPheThrSerPheValSerGlyA
400 410 420
ATTATGTTTGGAATGTAGATAGTGGCTTAA
spTyrValTrpAsnValAspSerGlyLeuT
,1 430 440 450
CGTTAGATAAATTTGATTCTGTTGTGCCTG
hrLeuAspLysPheAspSerValValProV
460 470 480
TCAATTTAATTCAAAAAGGTAAATCTAGCG
alAsnLeuIleGlnLysGlyLysSerSerA
,1 490 500 510
ATAATATCATCGTCAAAAATTGTGATGTAA
spAsnIleIleValLysAsnCysAspValA
520 530 540
ACGTAAAAGCAACTAAAAAAGCAAATTATT
snValLysAlaThrLysLysAlaAsnLeu*
,1 550 560 570
AATTAATCCCAAATGACCAGCATAATTGCT
oc
580 590 600
GGTTATTTATCTTCCTCGAGGGGAGATTTT
610 620 630 640 650 660
TTCTTGA (SEQ. ID. NO: 1)
encoding a polypeptide comprising immunoreactive epitopes of the 15 kD outer membrane protein of Haemophilus influenzae.
2. A vector comprising a recombinant polynucleotide, wherein the recombinant polynucleotide is the recombinant polynucleotide of claim 1 .
3. A host cell transformed with the vector of claim 2 .
4. A recombinant expression system comprising a polynucleotide encoding a polypeptide comprising one or more immunoreactive epitopes of the 15 kD outer membrane protein of claim 1 , wherein the polynucleotide is operably linked to a control sequence compatible with a desired host.
5. A cell transformed with a recombinant expression system, wherein the expression system is the recombinant expression system of claim 4 .
6. A recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 .
7. The recombinant polynucleotide of claim 6 , comprising the nucleotide sequence of SEQ ID NO: 3 .
8. A recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 .
9. A recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 .
10. The recombinant vector of claim 9 , wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 .
11. A recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 .
12. A host cell transformed with a vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 .
13. The host cell of claim 12 , wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 .
14. A host cell transformed with a vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 .
15. A recombinant expression system comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 operably linked to a control sequence compatible with a desired host.
16. The recombinant expression system of claim 15 , wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 .
17. A recombinant expression system comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 operably linked to a control sequence compatible with a desired host.
18. A cell transformed with a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 .
19. The cell of claim 18 , wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 .
20. A cell transformed with a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 .
21. A method of making a recombinant vector capable of expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 , comprising
inserting a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 into a plasmid.
22. The method of claim 21 , wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 .
23. A method of making a recombinant vector capable of expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 , comprising
inserting a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 into a plasmid.
24. A method of making a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 , comprising
culturing a host cell transformed with a recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 , whereby the host cell expresses the polypeptide, and
isolating the polypeptide.
25. The method of claim 24 , wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 .
26. A method of making a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 , comprising
culturing a host cell transformed with a recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 , whereby the host cell expresses the polypeptide, and
isolating the polypeptide.Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.