USRE38352EExpiredUtilityPatentIndex 91

Polymerase chain reaction assays for monitoring antiviral therapy and making therapeutic decisions in the treatment of acquired immunodeficiency syndrome

Assignee: UNIV LELAND STANFORD JUNIORPriority: May 14, 1992Filed: Sep 5, 2002Granted: Dec 16, 2003

Est. expiryMay 14, 2012(expired)· nominal 20-yr term from priority

Inventors:KOZAL MICHAEL J MERIGAN THOMAS C

C12Q 1/703C12Q 2600/106C12Q 2600/156

PatentIndex Score

Cited by

References

Claims

Abstract

The present invention relates to methods of monitoring, via polymerase chain reaction, the clinical progression of human immunodeficiency virus infection and its response to antiretroviral therapy. According to the invention, polymerase chain reaction assays may be used to predict immunological decline and to identify, at an early stage, patients whose infection has become resistant to a particular antiretroviral drug regimen.

Claims

exact text as granted — not AI-modified

What is claimed is:

1. A method of evaluating the effectiveness of antiretroviral therapy of an HIV-infected patient comprising:
(i) collecting a plasma sample from an HIV-infected patient; and
(ii) determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at codons codon 215 or 74, or codons 215 and 74 , in which the presence of the mutations mutation correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the mutations mutation.

2. The method of claim 1 in which the mutation at codon 215, 74, or 215 and 74 are is determined by a method comprising polymerase chain reaction (PCR).

3. The method of claim 2 which comprises a “nested” polymerase chain reaction.

4. The method of claim 2 which utilizes primer B (5′-GGATGGAAAGGATCACC-3′)(SEQ ID NO:9).

5. The method of claim 2 which utilizes primer 3M (3′-AAGTGTGGTCTGTTTTTTGTA-5′)(SEQ ID NO:11).

6. The method of claim 2 which utilizes primer 74WT (5′-AAGTTCTCTGAAATCTACTTA-3′)(SEQ ID NO:5).

7. The method of claim 2 which utilizes primer 74MUT (5′-AAGTTCTCTGAAATCTACTTC-3′)(SEQ ID NO:6).

8. The method of claim 2 which utilizes primer X2 (5′-AACAATGGCCATTGACAGA-3′)(SEQ ID NO:4).

9. The method of claim 1 in which the antiretroviral agent therapy being evaluated comprises zidovudine.

10. The method of claim 1 in which the antiretroviral agent therapy being evaluated comprises didanosine.

11. The method of claim 2 wherein PCR is repeated for 30 to 40 cycles.

12. The method of claim 11 wherein PCR is repeated for 30-35 cycles.

13. A method of evaluating the effectiveness of antiretroviral therapy of an HIV-infected patient comprising:
(i) collecting PBMC from an HIV-infected patient; and
(ii) determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codons 74 or codon 215, or codons 215 and 74, of the HIV reverse transcriptase gene, in which the presence of the mutations mutation correlates positively with an accelerated immunologic decline of said patient compared with patients who do not have the mutations mutation.

14. The method of claim 13 in which the mutations mutation at codons 74 or codon 215, or 215 and 74 are is determined by a method comprising polymerase chain reaction.

15. The method of claim 14 which comprises a nested polymerase chain reaction.

16. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:
( i ) collecting a plasma sample from an HIV - infected patient; and
( ii ) determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at codon 74 , in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the mutation.

17. The method of claim 16 in which the mutation at codon 74 , is determined by a method comprising polymerase chain reaction ( PCR ).

18. The method of claim 17 which comprises a “nested” polymerase chain reaction.

19. The method of claim 17 which utilizes primer B ( 5 ′ - GGATGGAAAGGATCACC - 3 ′)( SEQ ID NO: 9 ).

20. The method of claim 17 which utilizes primer 3 M ( 3 ′- AAGTGTGGTCTGTTTTTTGTA - 5 ′)( SEQ ID NO: 11 ).

21. The method of claim 17 which utilizes primer 74 WT ( 5 ′- AAGTTCTCTGAAATCTACTTA - 3 ′)( SEQ ID NO: 5 ).

22. The method of claim 17 which utilizes primer 74 MUT ( 5 ′- AAGTTCTCTGAAATCTACTTC - 3 ′)( SEQ ID NO: 6 ).

23. The method of claim 17 which utilizes primer X 2 ( 5 ′- AACAATGGCCATTGACAGA - 3 ′)( SEQ ID NO: 4 ).

24. The method of claim 16 in which the antiretroviral therapy being evaluated comprises zidovudine.

25. The method of claim 16 in which the antiretroviral therapy being evaluated comprises didanosine.

26. The method of claim 17 wherein PCR is repeated for 30 to 40 cycles.

27. The method of claim 26 wherein PCR is repeated for 30 - 35 cycles.

28. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:
( i ) collecting a plasma sample from an HIV - infected patient; and
( ii ) determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at codons 215 and 74 , in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the mutation.

29. The method of claim 28 in which the mutation at codons 215 and 74 is determined by a method comprising polymerase chain reaction ( PCR ).

30. The method of claim 29 which comprises a “nested” polymerase chain reaction.

31. The method of claim 29 which utilizes primer B ( 5 ′ - GGATGGAAAGGATCACC - 3 ′)( SEQ ID NO: 9 ).

32. The method of claim 29 which utilizes primer 3 M ( 3 ′- AAGTGTGGTCTGTTTTTTGTA - 5 ′)( SEQ ID NO: 11 ).

33. The method of claim 29 which utilizes primer 74 WT ( 5 ′- AAGTTCTCTGAAATCTACTTA - 3 ′)( SEQ ID NO: 5 ).

34. The method of claim 29 which utilizes primer 74 MUT ( 5 ′- AAGTTCTCTGAAATCTACTTC - 3 ′)( SEQ ID NO: 6 ).

35. The method of claim 29 which utilizes primer X 2 ( 5 ′- AACAATGGCCATTGACAGA - 3 ′)( SEQ ID NO: 4 ).

36. The method of claim 28 in which the antiretroviral therapy being evaluated comprises zidovudine.

37. The method of claim 28 in which the antiretroviral therapy being evaluated comprises didanosine.

38. The method of claim 29 wherein PCR is repeated for 30 to 40 cycles.

39. The method of claim 38 wherein PCR is repeated for 30 - 35 cycles.

40. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:
( i ) collecting PBMC from an HIV - infected patient; and
( ii ) determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codon 74 of the HIV reverse transcriptase gene, in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared with patients who do not have the mutation.

41. The method of claim 40 in which the mutation at codon 74 is determined by a method comprising polymerase chain reaction.

42. The method of claim 41 which comprises a nested polymerase chain reaction.

43. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:
( i ) collecting PBMC from an HIV - infected patient; and
( ii ) determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codons 215 and 74 , of the HIV reverse transcriptase gene, in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared with patients who do not have the mutation.

44. The method of claim 43 in which the mutation at codons 215 and 74 is determined by a method comprising polymerase chain reaction.

45. The method of claim 44 which comprises a nested polymerase chain reaction.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.