Recombinant Venezuelan Equine Encephalitis virus vaccine

Abstract

A prophylactic or therapeutic vaccine for use in protecting mammals such as humans or animals against Venezelan Equine Encephalitis virus (VEE) is described. In particular, the vaccine comprises a recombinant virus such as a recombinant vaccinia virus which is able to express the structural genes of VEE in attenuated form, which has been modified to increase the protective effect of the vaccine. This is achieved by modifying the sequence of the attenuated VEE strain and/or putting this under the control of modified promoter which increases expression from the vector. Formulations of the vaccine as well as methods of treatment using the vaccine are also described.

1. A vaccine for the therapeutic or prophylactic immunisation against Venezuelan Equine Encephalitis (VEE) virus, said vaccine comprising a vector which includes a sequence which encodes an attenuated form of said virus which is capable of producing a protective immune response, wherein the said sequence is such that the amino acid at position 7 in the E2 protein of VEE is lysine. 
     
     
       2. A vaccine according to  claim 1  wherein the attenuated form of said virus comprises a derivative of the TC-83 construct. 
     
     
       3. A vaccine according to  claim 2  wherein the vector comprises a virus vector. 
     
     
       4. A vaccine according to  claim 3  wherein the virus is selected from an attenuated virus. 
     
     
       5. A vaccine according to  claim 3  wherein the virus is selected from vaccinia, adenovirus or herpes simplex virus (HSV). 
     
     
       6. A vaccine according to  claim 5  which comprises an attenuated vaccinia virus. 
     
     
       7. A vaccine according to  claim 6 , wherein expression of the said attenuated VEE virus is under the control of a synthetic 7.5K vaccinia promoter which has been subject to mutation which Increases the level of VEE virus protein production as compared to the wild-type 7.5K promoter. 
     
     
       8. A vaccine according to  claim 7  wherein the said 7.5K promoter comprises the sequence
 TAAAAATTGAAAATACATTCTAATTTATTGCAC (SEQ ID No 2).  
 
     
     
       9. A vaccine according to  claim 1  which comprises a vector which includes a nucleotide sequence which encodes a further immunogenic peptide, and is able to express said sequence when administered to a mammal. 
     
     
       10. A vaccine according to  claim 1  which further comprises a cytokine or an active fragment or variant thereof, or a vector which comprises a nucleotide sequence which encodes a cytokine or an active fragment or variant thereof. 
     
     
       11. A vaccine according to  claim 10  which comprises a vector which comprises a nucleotide sequence which encodes a cytokine or an active fragment or variant thereof. 
     
     
       12. A vaccine according to  claim 10  wherein the cytokine is an interleukin. 
     
     
       13. A vaccine according to  claim 10  wherein the interleukin is selected from human IL-2 or human IL-6. 
     
     
       14. A pharmaceutical composition comprising a vaccine as defined in  claim 1  and a pharmaceutically acceptable carrier or excipient. 
     
     
       15. A method for producing a protective immune response against VEE virus in a mammal, which method comprises administering to said mammal, a vaccine according to  claim 1 . 
     
     
       16. A method according to  claim 15  wherein the mammal is either a human or a horse. 
     
     
       17. A method for producing a protective immune response against Venezuelan Equine Encephalitis ( VEE )  virus in a mammal, which method comprises administering to said mammal, a vaccine against VEE virus comprising a vector which comprises a sequence encoding the N - terminal  19  amino acids of the E 2  protein of VEE, said vaccine being capable of producing a protective immune response, wherein the said sequence is such that the amino acid at position  7  in the E 2  protein is lysine, wherein the vector encodes an attenuated form of said virus which is capable of producing a protective immune response.    
     
     
       18. A method of  claim 17  wherein the fragment encodes the N- terminal  25  amino acids of the E 2  protein of VEE and the amino acid at position  7  in the E 2  protein is lysine.    
     
     
       19. A method according to  claim 17  wherein the attenuated form of said virus comprises a derivative of the TC-   83  construct.    
     
     
       20. A method according to  claim 17  wherein the vector comprises a virus vector.  
     
     
       21. A method according to  claim 20  wherein the virus vector is selected from an attenuated virus.  
     
     
       22. A method according to  claim 21  wherein the attenuated virus is a virus selected from vaccinia, adenovirus or herpes simplex virus ( HSV ).  
     
     
       23. A method according to  claim 22  wherein the attenuated virus is an attenuated vaccinia virus.  
     
     
       24. A method according to  claim 23 , wherein expression of the sequence encoding the N- terminal  19  amino acids of the E 2  protein of VEE is under the control of a synthetic  7 . 5 K vaccinia promoter which has been subject to mutation which increases the level of VEE virus protein production as compared to the wild - type  7 . 5  promoter.    
     
     
       25. A method according to  claim 24  wherein the  7 . 5 K promoter comprises the sequence
   TAAAAATTGAAAATACATTCTAATTTATTGCAC  ( SEQ ID NO:  2   ).    
     
     
       26. A method according to  claim 17  wherein the vaccine further comprises a vector which includes a nucleotide sequence which encodes a further immunogenic peptide, and is able to express said sequence when administered to a mammal.  
     
     
       27. A vaccine for the therapeutic or prophylactic immunisation against Venezuelan Equine Encephalitis ( VEE )  virus, said vaccine comprising a virus vector which comprises a sequence encoding the N - terminal  19  amino acids of the E 2  protein of VEE, said vaccine being capable of producing a protective immune response, wherein the said sequence is such that the amino acid at position  7  in the E 2  protein is lysine,      said vaccine further comprising a cytokine or an active fragment or variant thereof, or a vector which comprises a nucleotide sequence which encodes a cytokine or an active fragment or variant thereof.      
     
     
       28. A vaccine according to  claim 27  which comprises a vector which comprises a nucleotide sequence which encodes a cytokine or an active fragment or variant thereof.  
     
     
       29. A vaccine according to  claim 27  wherein the cytokine is an interleukin.  
     
     
       30. A vaccine according to  claim 27  wherein the interleukin is selected from human IL-   2  or human IL -   6 .    
     
     
       31. A pharmaceutical composition comprising a vaccine as defined in  claim 27  and a pharmaceutically acceptable carrier or excipient.  
     
     
       32. A method for producing a protective immune response against VEE virus in a mammal, which method comprises administering to said mammal, a vaccine according to  claim 27 .  
     
     
       33. A method according to  claim 32  wherein the mammal is either a human or a horse.  
     
     
       34. A method according to  claim 17  wherein the mammal is either a human or a horse.