USRE46873EActiveUtility

Multi-targeted RNAi therapeutics for scarless wound healing of skin

84
Assignee: SIRNAOMICS INCPriority: Nov 6, 2007Filed: Nov 6, 2008Granted: May 29, 2018
Est. expiryNov 6, 2027(~1.3 yrs left)· nominal 20-yr term from priority
C12N 15/1138A61K 31/7105C12N 2310/14A61P 17/02C12N 15/1136
84
PatentIndex Score
5
Cited by
44
References
21
Claims

Abstract

The present invention provides small interfering RNA (siRNA) molecules, compositions containing them, and methods of using them for improvement of skin scarless wound healing and other skin conditions, such as psoriasis and lupus-caused cutaneous lesions. The invention includes siRNA molecules and compositions containing them that inhibit the expression of one or more genes that promote pathological or undesired processes in wound healing and methods of using them.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
       1. A composition comprising at least three siRNA molecules and a pharmaceutically acceptable carrier, wherein each siRNA molecule binds an mRNA molecule that is encoded by a gene selected from the group consisting of TGF-β1, Cox-2, and Hoxb13, wherein said molecules inhibit expression of said genes in both human and mouse cells, wherein said composition comprises a nanoparticle, and wherein said siRNA molecules comprise the following oligonucleotides: 
       
         
           
                 
               
                   (1) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ 
                 
                   (SEQ ID NO: 11) 
                 
                   antisense, 5′AGAAGUUGGCAUGGUAGCCCUUGGG-3′; 
                 
                   (SEQ ID NO: 12) 
                 
                     
                 
                   (2) hmCX-1: sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′, 
                 
                   (SEQ ID NO: 9) 
                 
                   antisense, 5′-ACAUCAUCAGACCAGGCACCAGACC-3′; 
                 
                   (SEQ ID NO: 10) and 
                 
                     
                 
                   (3) hmHX-1: sense, 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ 
                 
                   (SEQ ID NO: 7 
                 
                   antisense, 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ 
                 
                   (SEQ ID NO: 8). 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
       2. The composition of  claim 1 , wherein said pharmaceutically acceptable carrier comprises a branched histidine polypeptide or a branched lysine polypeptide. 
     
     
       3. A method for treating a dermal or epidermal wound in a subject, wherein said wound is characterized at least in part by inflammation and neovascularization, said method comprising administering to said subject a pharmaceutically effective amount of the composition of  claim 1 . 
     
     
       4. The method of  claim 3  wherein said subject is a mammal. 
     
     
       5. The method of  claim 3  wherein said subject is a human. 
     
     
       6. A composition comprising at least three siRNA molecules, wherein each siRNA molecule binds an mRNA molecule that is encoded by a gene selected from the group consisting of TGF-β1, Cox-2, and Hoxb13, and a pharmaceutically acceptable carrier, wherein said siRNA molecules comprise the following oligonucleotides: 
       
         
           
                 
               
                   (1) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ 
                 
                   (SEQ ID NO: 11) 
                 
                   antisense, 5′AGAAGUUGGCAUGGUAGCCCUUGGG-3′; 
                 
                   (SEQ ID NO: 12) 
                 
                     
                 
                   (2) hmCX-1: sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′, 
                 
                   (SEQ ID NO: 9) 
                 
                   antisense, 5′-ACAUCAUCAGACCAGGCACCAGACC-3′;  
                 
                   (SEQ ID NO: 10) and 
                 
                     
                 
                   (3) hmHX-1: sense, 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ 
                 
                   (SEQ ID NO: 7) 
                 
                   antisense, 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ 
                 
                   (SEQ ID NO: 8). 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
       7. The composition of  claim 1 , wherein said pharmaceutically acceptable carrier comprises a branched histidine-lysine peptide. 
     
     
       8. The composition of  claim 6 , wherein said pharmaceutically acceptable carrier comprises a branched histidine polypeptide or a branched lysine polypeptide. 
     
     
       9. The composition of  claim 6 , wherein said pharmaceutically acceptable carrier comprises a branched histidine-lysine peptide. 
     
     
       10. The composition of  claim 6 , wherein said composition comprises a nanoparticle. 
     
     
       11. The composition of  claim 8 , wherein said composition comprises a nanoparticle. 
     
     
       12. The composition of  claim 9 , wherein said composition comprises a nanoparticle. 
     
     
       13. A composition comprising at least two siRNA molecules and a pharmaceutically acceptable carrier, wherein said siRNA molecules comprise the following oligonucleotides: 
       
         
           
                 
               
                   (1) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ 
                 
                   (SEQ ID NO: 11) 
                 
                     
                 
                 
                 
               
                     
                   antisense, 5′AGAAGUUGGCAUGGUAGCCCU 
                 
                     
                   UGGG-3′ (SEQ ID NO: 12), and 
                 
                     
                 
                 
               
                   (2) hmCX-1: sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ 
                 
                   (SEQ ID NO: 9) 
                 
                     
                 
                 
                 
               
                     
                   antisense, 5′-ACAUCAUCAGACCAGGCACC 
                 
                     
                   AGACC-3′ (SEQ ID NO: 10). 
                 
             
                
                
                
               
            
             
                
                
                
               
            
             
                
                
                
               
            
             
                
                
               
            
           
         
       
       
        
       
     
     
       14. The composition of claim 13, wherein said pharmaceutically acceptable carrier comprises a branched histidine polypeptide or a branched lysine polypeptide. 
     
     
       15. The composition of claim 13, wherein said pharmaceutically acceptable carrier comprises a branched histidine-lysine polymer. 
     
     
       16. The composition of claim 13, wherein said composition comprises a nanoparticle. 
     
     
       17. The composition of claim 14, wherein said composition comprises a nanoparticle. 
     
     
       18. The composition of claim 15, wherein said composition comprises a nanoparticle. 
     
     
       19. A method for treating a dermal or epidermal wound in a mammal, wherein said wound is characterized at least in part by inflammation and neovascularization, said method comprising administering to said mammal a pharmaceutically effective amount of the composition of claim 13. 
     
     
       20. The method of claim 19 wherein said mammal is a human. 
     
     
       21. A method for treating a dermal or epidermal wound in a human, wherein said wound is characterized at least in part by inflammation and neovascularization, said method comprising administering to said human a pharmaceutically effective amount of the composition of claim 18.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.