USRE50283EActiveUtility
Effective delivery of large genes by dual AAV vectors
Est. expiryApr 18, 2033(~6.8 yrs left)· nominal 20-yr term from priority
C12N 2840/44A61K 48/005C12N 2840/445C07K 14/705C12N 2840/20C12N 2800/40C12N 2750/14143C12N 15/86A61P 27/02
63
PatentIndex Score
1
Cited by
184
References
55
Claims
Abstract
The present invention relates to constructs, vectors, relative host cells and pharmaceutical compositions which allow an effective gene therapy, in particular of genes larger than 5 Kb.
Claims
exact text as granted — not AI-modifiedThe invention claimed is:
1. A dual construct system to express the coding sequence of a gene of interest in a host cell, said coding sequence consisting of a 5′end portion and of a 3′end portion, said dual construct system comprising:
a) a first plasmid comprising, in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a promoter sequence;
the 5′ end portion of said coding sequence, said 5′end portion being operably linked to and under control of said promoter;
a nucleic acid sequence of a splicing donor signal; and
a 3′-inverted terminal repeat (3′-ITR) sequence; and
b) a second plasmid comprising, in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a splicing acceptor signal;
the 3′end of said coding sequence;
a poly-adenylation signal nucleic acid sequence;
a 3′-inverted terminal repeat (3′-ITR) sequence;
wherein the nucleotide sequence of the respective ITRs is obtained from an adeno-associated virus (AAV) of the same AAV serotype or from an AAV of a different serotype;
wherein said first plasmid further comprises a nucleic acid sequence of a recombinogenic region in 5′ position of the 3′ITR of said first plasmid, and wherein said second plasmid further comprises a nucleic acid sequence of a recombinogenic region in 3′ position of the 5′-ITR of said second plasmid; and
wherein the recombinogenic region is an F1 phage recombinogenic region that consists of the sequence:
(SEQ ID NO: 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT.
2. The dual construct system according to claim 1 , wherein upon introduction of said first plasmid and said second plasmid into the host cell, said coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals.
3. The dual construct system according to claim 1 , wherein the 3′-ITR of the first plasmid and the 5′-ITR of the second plasmid are from the same AAV serotype.
4. The dual construct system according to claim 1 , wherein the 5′-ITR and 3′-ITR of the first plasmid and the 5′-ITR and 3′-ITR of the second plasmid are respectively from different AAV serotypes.
5. The dual construct system according to claim 1 , wherein the 5′-ITR of the first plasmid and the 3′-ITR of the second plasmid are from different AAV serotypes.
6. The dual construct system according to claim 1 , wherein the coding sequence is split into the 5′ end portion and the 3′ end portion at a natural exon-exon junction.
7. The dual construct system according to claim 1 , wherein the nucleic acid sequence of the splicing donor signal comprises the sequence:
(SEQ ID NO: 1)
GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG
CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT.
8. The dual construct system according to claim 1 , wherein the nucleic acid sequence of the splicing acceptor signal comprises the sequence
(SEQ ID NO: 2)
GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA
G.
9. The dual construct system according to claim 1 , wherein the first plasmid further comprises at least one enhancer sequence, operably linked to the coding sequence.
10. The dual construct system according to claim 1 , wherein the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration.
11. The dual construct system according to claim 10 , wherein the coding sequence is selected from the group consisting of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98 and ALMS1.
12. A dual viral vector system comprising:
a) a first viral vector containing the first plasmid, and
b) a second viral vector containing the second plasmid,
wherein said first and said second plasmids are as defined in claim 1 , and
wherein the vectors are adeno-associated virus (AAV) vectors.
13. The dual viral vector system according to claim 12 , wherein the adeno-associated virus (AAV) vectors are the same or different AAV serotypes.
14. The dual viral vector system according to claim 12 , wherein the AAV vectors have a serotype selected from the group consisting of serotype 2, serotype 8, serotype 5, serotype 7 and serotype 9.
15. An isolated host cell transformed with the dual viral vector system according to claim 12 .
16. A pharmaceutical composition comprising the dual construct system according to claim 1 , and a pharmaceutically acceptable vehicle.
17. A method for treating a subject having a disease characterized by a retinal degeneration comprising subretinally administering to said subject an effective amount of the dual viral vector system according to claim 12 .
18. A pharmaceutical composition comprising the dual viral vector system according to claim 12 and a pharmaceutically acceptable vehicle.
19. A pharmaceutical composition comprising the isolated host cell according to claim 15 and a pharmaceutically acceptable vehicle.
20. A first polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a promoter sequence;
a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;
a nucleic acid sequence of a splicing donor signal;
a nucleic acid sequence of a recombinogenic region; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO: 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.
21. The first polynucleotide of claim 20 , capable of undergoing homologous recombination with a second polynucleotide that comprises the Fl phage recombinogenic region.
22. The first polynucleotide of claim 20 , wherein:
the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from an AAV of the same AAV serotype or a different AAV serotype; the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from AAV serotype 2; the coding sequence is split into the 5′ end portion at a natural exon-exon junction; the nucleic acid sequence of the splicing donor signal comprises
(SEQ ID NO: 1)
GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG
CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT;
the 5′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size; and/or
the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration, optionally wherein the coding sequence is selected from the group consisting of the gene coding sequences of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98, and ALMS1.
23. The first polynucleotide of claim 20 , wherein the promoter sequence is selected from the group consisting of a cytomegalovirus (CMV) promoter sequence, a chicken beta-actin (CBA) promoter sequence, a vitelliform macular dystrophy 2 (VMD2) promoter sequence, a interphotoreceptor retinoid binding protein promoter sequence, a rhodopsin (RHO) promoter sequence, and a rhodopsin kinase (RHOK) promoter sequence, optionally wherein the first polynucleotide further comprises at least one enhancer and/or intron sequence, operably linked to the coding sequence.
24. A first viral vector comprising the first polynucleotide of claim 20 , optionally wherein the vector is an AAV vector, optionally wherein:
the adeno-associated virus is selected from serotype 2, serotype 8, serotype 5, serotype 7, and serotype 9; and/or the AAV vector is AAV2/8.
25. An isolated host cell transformed with the first viral vector of claim 24 .
26. A pharmaceutical composition comprising the first viral vector of claim 24 and pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.
27. A second polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a recombinogenic region;
a nucleic acid sequence of a splicing acceptor signal;
a 3′ end portion of a coding sequence of a gene of interest;
a poly-adenylation signal nucleic acid sequence; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO: 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.
28. The second polynucleotide of claim 27 , capable of undergoing homologous recombination with a first polynucleotide that comprises the Fl phage recombinogenic region.
29. The second polynucleotide of claim 27 , wherein:
the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from an AAV of the same AAV serotype or a different AAV serotype; the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from AAV serotype 2; the coding sequence is split into the 3′ end portion at a natural exon-exon junction; the nucleic acid sequence of the splicing acceptor signal comprises
(SEQ ID NO: 2)
GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA
G;
the 3′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size; and/or
the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration, optionally wherein the coding sequence is selected from the group consisting of the gene coding sequences of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98, and ALMS1.
30. The second polynucleotide of claim 27 , wherein the poly-adenylation signal nucleic acid sequence comprises a bovine growth hormone (BGH) poly-adenylation signal or a simian virus 40 (SV40) poly-adenylation signal.
31. A second viral vector comprising the second polynucleotide of claim 27 , optionally wherein the vector is an AAV vector, optionally wherein:
the adeno-associated virus is selected from serotype 2, serotype 8, serotype 5, serotype 7, and serotype 9; and/or the AAV vector is AAV2/8.
32. An isolated host cell transformed with the second viral vector of claim 31 .
33. A pharmaceutical composition comprising the second viral vector of claim 31 and pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.
34. A dual construct system to express a coding sequence of a gene of interest in a host cell, the coding sequence having a 5′ end portion and a 3′ end portion, the dual construct system comprising:
a) a first polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a promoter sequence;
a 5′ end portion of the coding sequence of the gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;
a nucleic acid sequence of a splicing donor signal;
a nucleic acid sequence of a recombinogenic region; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and
b) a second polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a recombinogenic region;
a nucleic acid sequence of a splicing acceptor signal;
a 3′ end portion of the coding sequence of the gene of interest;
a poly-adenylation signal nucleic acid sequence; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.
35. The dual construct system of claim 34 , wherein upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals.
36. The dual construct system of claim 34 , wherein:
upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide; or upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of ITR-mediated concatemerization; or upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by one or both of: (i) ITR-mediated concatemerization; and (ii) homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide, followed by splicing through the splicing donor and the splicing acceptor signals for the production of a mature mRNA.
37. The dual construct system of claim 34 , wherein:
the 3′-ITR of the first polynucleotide and the 5′-ITR of the second polynucleotide are from the same AAV serotype; the 5′-ITR and 3′-ITR of the first polynucleotide and the 5′-ITR and 3′-ITR of the second polynucleotide are respectively from different AAV serotypes; the 5′-ITR of the first polynucleotide and the 3′-ITR of the second polynucleotide are from different AAV serotypes; the nucleotide sequence of the 5′-ITR and 3′-ITR of the first polynucleotide and the second polynucleotide are obtained from AAV serotype 2; the coding sequence is split into the 5′ end portion and the 3′ end portion at a natural exon-exon junction; the nucleic acid sequence of the splicing donor signal comprises the sequence:
(SEQ ID NO: 1)
GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG
CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT;
the nucleic acid sequence of the splicing acceptor signal comprises the sequence
(SEQ ID NO: 2)
GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA
G;
the 5′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size;
the 3′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size;
the first polynucleotide further comprises at least one enhancer and/or intron sequence, operably linked to the coding sequence; and/or
the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration, optionally wherein the coding sequence is selected from the group consisting of the gene coding sequences of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98, and ALMS1.
38. The dual construct system of claim 34 , wherein:
the promoter sequence is selected from the group consisting of a cytomegalovirus (CMV) promoter sequence, a chicken beta-actin (CBA) promoter sequence, a vitelliform macular dystrophy 2 (VMD2) promoter sequence, a interphotoreceptor retinoid binding protein promoter sequence, a rhodopsin (RHO) promoter sequence, and a rhodopsin kinase (RHOK) promoter sequence; and/or the poly-adenylation signal nucleic acid sequence comprises a bovine growth hormone (BGH) poly-adenylation signal or a simian virus 40 (SV40) poly-adenylation signal.
39. A dual viral vector system comprising: a) a first viral vector containing the first polynucleotide, and b) a second viral vector containing the second polynucleotide, wherein said first and said second polynucleotides are as defined in claim 34 , and wherein the vectors are AAV vectors, optionally wherein:
the AAV vectors are the same or different AAV serotypes; the AAV vectors have a serotype selected from the group consisting of serotype 2, serotype 8, serotype 5, serotype 7 and serotype 9; the AAV vector is AAV2/8; the dual viral vector system is capable of transducing one or both of retinal pigment epithelium and photoreceptors; and/or the dual viral vector system is capable of inducing stronger expression of the gene of interest compared to a dual AAV trans-splicing vector system.
40. An isolated host cell transformed with the dual viral vector system according to claim 39 .
41. A pharmaceutical composition comprising the dual viral vector system of claim 39 , and a pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.
42. A method for treating a subject having a disease characterized by a retinal degeneration comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 39 , optionally wherein the disease characterized by a retinal degeneration is Usher 1B and the coding sequence is of a MYO7A gene.
43. A dual construct system to express a coding sequence of a gene of interest in an host cell, the coding sequence having a 5′ end portion and a 3′ end portion, the dual construct system comprising:
a) a first polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a chicken beta-actin (CBA) promoter sequence;
a 5′ end portion of the coding sequence of a MYO7A gene, the 5′ end portion being operably linked to and under control of the promoter sequence;
a nucleic acid sequence of a splicing donor signal;
a nucleic acid sequence of a recombinogenic region; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and
b) a second polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a recombinogenic region;
a nucleic acid sequence of a splicing acceptor signal;
a 3′ end portion of the coding sequence of a MYO7A gene;
a bovine growth hormone (BGH) poly-adenylation signal nucleic acid sequence; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.
44. The dual construct system of claim 43 , wherein:
upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals; upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide; the 3′-ITR of the first polynucleotide and the 5′-ITR of the second polynucleotide are from the same AAV serotype; the 5′-ITR and 3′-ITR of the first polynucleotide and the 5′-ITR and 3′-ITR of the second polynucleotide are respectively from different AAV serotypes; the 5′-ITR of the first polynucleotide and the 3′-ITR of the second polynucleotide are from different AAV serotypes; the nucleotide sequence of the 5′-ITR and 3′-ITR of the first polynucleotide and the second polynucleotide are obtained from AAV serotype 2; the coding sequence is split into the 5′ end portion and the 3′ end portion at a natural exon-exon junction; the MYO7A coding sequence is split between exons 24-25; the nucleic acid sequence of the splicing donor signal comprises the sequence:
(SEQ ID NO: 1)
GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG
CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT;
the nucleic acid sequence of the splicing acceptor signal comprises the sequence
(SEQ ID NO: 2)
GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA
G;
and/or
the first polynucleotide further comprises at least one enhancer and/or intron sequence, operably linked to the coding sequence.
45. A dual viral vector system comprising: a) a first viral vector containing the first polynucleotide, and b) a second viral vector containing the second polynucleotide, wherein said first and said second polynucleotides are as defined in claim 43 , and wherein the vectors are AAV vectors, optionally wherein:
the AAV vectors are the same or different AAV serotypes; the AAV vectors have a serotype selected from the group consisting of serotype 2, serotype 8, serotype 5, serotype 7 and serotype 9; and/or the AAV vector is AAV2/8.
46. The dual viral vector system of claim 45 ,
capable of transducing one or both of retinal pigment epithelium and photoreceptors; capable of inducing stronger expression of MYO7A compared to a dual AAV trans-splicing vector system; and/or capable of transducing retina to a higher level compared to an oversized AAV vector system or a dual viral vector system comprising an alkaline phosphatase (AP) recombinogenic region.
47. An isolated host cell transformed with the dual viral vector system according to claim 45 , optionally wherein the host cell is a human cell.
48. A pharmaceutical composition comprising the dual viral vector system of claim 45 , and a pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.
49. A method for treating a subject having Usher 1B, comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 45 .
50. A method for correctly localizing retinal pigment epithelium (RPE) melanosomes apically, comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 45 .
51. A method for reducing the accumulation of rhodopsin at the connecting cilium of photoreceptors, comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 45 .
52. A method to induce genetic recombination in a host cell, the method comprising introducing into the host cell a dual construct system, wherein the dual construct system comprises:
a) a first polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a promoter sequence;
a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;
a nucleic acid sequence of a splicing donor signal;
a nucleic acid sequence of a recombinogenic region; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and
b) a second polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a recombinogenic region;
a nucleic acid sequence of a splicing acceptor signal;
a 3′ end portion of a coding sequence of the gene of interest;
a poly-adenylation signal nucleic acid sequence; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.
53. The method of claim 52 , wherein:
upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals; and/or upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide.
54. A method for reconstituting a coding sequence in a host cell, the method comprising introducing into the host cell a dual construct system, wherein the dual construct system comprises:
a) a first polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a promoter sequence;
a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;
a nucleic acid sequence of a splicing donor signal;
a nucleic acid sequence of a recombinogenic region; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and
b) a second polynucleotide comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a recombinogenic region;
a nucleic acid sequence of a splicing acceptor signal;
a 3′ end portion of a coding sequence of the gene of interest;
a poly-adenylation signal nucleic acid sequence; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.
55. A dual viral vector system comprising:
a) a first viral vector comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a promoter sequence;
a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;
a nucleic acid sequence of a splicing donor signal;
a nucleic acid sequence of a recombinogenic region; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and
b) a second viral vector comprising in a 5′-3′ direction:
a 5′-inverted terminal repeat (5′-ITR) sequence;
a nucleic acid sequence of a recombinogenic region;
a nucleic acid sequence of a splicing acceptor signal;
a 3′ end portion of a coding sequence of the gene of interest;
a poly-adenylation signal nucleic acid sequence; and
a 3′-inverted terminal repeat (3′-ITR) sequence,
wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:
(SEQ ID NO. 3)
GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTTTAACAAAAT;
or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.