Probe, probe set, probe carrier, and testing method

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 2 and mutated sequences thereof.

1 - 7 . (canceled) 
     
     
         8 . A method of detecting a DNA of  Candida intermedia  in a sample by using a probe carrier, comprising:
 (i) reacting the sample with the probe carrier comprising a probe immobilized on a carrier, wherein the probe comprises one of the following base sequence (1) to (3):   (1) gtgttgccttccgaaatatcacagttg (SEQ ID NO. 1) or a complementary sequence thereof;   (2) cagttgtcgcaatacgttacttcaacttt (SEQ ID NO. 2) or a complementary sequence thereof; and   (3) a mutated sequence which is obtained by deletion, substitution, or addition of a base on one of the sequences of SEQ ID NOS. 1 and 2 and the complementary sequences thereof within a range that the mutated sequence retains a function as the probe; and   (ii) detecting a reaction intensity of the probe on the probe carrier reacted with a nucleic acid contained in the sample.   
     
     
         9 . A method of detecting a DNA of  Candida intermedia  in a sample by using a probe carrier, comprising:
 (i) reacting the sample with the probe carrier comprising a plurality of probes each immobilized on a carrier and arranged at intervals, wherein the plurality of probes comprise at least two of the following probes (A) to (H):   (A) a probe including a base sequence represented by gtgttgccttccgaaatatcacagttg (SEQ ID NO. 1);   (B) a probe including a base sequence represented by cagttgtcgcaatacgttacttcaacttt (SEQ ID NO. 2);   (C) a probe including a complementary sequence of SEQ ID NO. 1;   (D) a probe including a complementary sequence of SEQ ID NO. 2;   (E) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 1 within a range that the mutated sequence retains a function as the probe;   (F) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on SEQ ID NO. 2 within a range that the mutated sequence retains the function as the probe;   (G) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 1 within a range that the mutated sequence retains the function as the probe; and   (H) a probe including a mutated sequence obtained by deletion, substitution or addition of a base on the complementary sequence of SEQ ID NO. 2 within a range that the mutated sequence retains the function as the probe; and   (ii) detecting a reaction intensity of the probe on the probe carrier reacted with a nucleic acid contained in the sample.   
     
     
         10 . The method of detecting a DNA of  Candida intermedia  according to  claim 9 , wherein the probe carrier comprises two probes consisting of the following base sequences (1) and (2) respectively to specifically detect  Candida intermedia:    (1) gtgttgccttccgaaatatcacagttg (SEQ ID NO. 1) or the complementary sequence thereof; and   (2) cagttgtcgcaatacgttacttcaacttt (SEQ ID NO. 2) or the complementary sequence thereof.   
     
     
         11 . The method of detecting a DNA of  Candida intermedia  according to  claim 9 , wherein the probe carrier comprises the following probes (a) and (b), and wherein the probe carrier does not comprise another probe to detect  Candida intermedia:    (a) a probe consisting of gtgttgccttccgaaatatcacagttg (SEQ ID NO. 1); and   (b) a probe consisting of cagttgtcgcaatacgttacttcaacttt (SEQ ID NO. 2).